The Biotechnology of Cannabis sativa!

[Velodrone]

The Biotechnology of Cannabis sativa
Sam R. Zwenger
April, 2009
! "!
! #!
This book is dedicated to the future of humankind. Please distribute it at no charge.
“I smoke pot, and I like it.â€
-Anonymous
Table of Contents:
Introduction
1. The Botany of Cannabis sativa
2. Plant Biotechnology
3. Tissue Culture
4. Agrobacterium tumefaciens
5. The GFP Leaf
6. Woody Cannabis
7. Terpene Production
8. The THC Pathway
9. Smoking Roses and Other Proposals
10. Cannabis DNA Sequencing
11. Molecular Tools
12. Marijuana Laws, Regulations, and Education
Appendix A: Representative list of interesting genes to be used for
Cannabis transformation.
Appendix B: Vendors of biotechnology equipment and reagents.
Glossary
! $!
Introduction
Marijuana, whose scientific name is Cannabis sativa, is perhaps the most famous plant
ever discovered by humans. Since its discovery it has been used by millions of people for
both inducing pleasure and alleviating pain. Cannabis has a rich history, complex biology
and a fascinating physiology.
Molecular biology and plant biotechnology are only beginning to uncover the secrets of
this plant. Scientists now have the opportunity to grow Cannabis plants in vitro (in a test
tube or Petri dish), thereby being able to genetically modify these plants in dozens of
ways. Fluorescent Cannabis, THC-producing roses, Cannabis that climbs like a vine, and
phenomenal increases in branch number and flower size are only a few of the ways in
which this plant can be enhanced through biotechnology.
Many would benefit from Cannabis biotechnology. For example, producing genetically
transformed, THC-containing weed species might be an effective way to bypass legal
issues and still allow sufferers of chronic illnesses to self-medicate. In other words, with
biotechnology the legalities concerning Cannabis cultivation diminish. Within the next
few years, through biotechnology, a surrogate plant will soon be created that synthesizes
THC. This might lead some policy makers to increase their vigilance against the THC
molecule itself. Conversely, they may finally put their war on this beneficial plant to rest.
The purpose of this book gives insight into the possibilities that biotechnology can
provide to the Cannabis community and the world. It begins with a botanical introduction
and continues with an explanation of biotechnology and techniques, examples and
purpose for genetically modifying Cannabis, THC biosynthesis and cellular interaction,
and information on some necessary molecular biology techniques.
The tools of biotechnology, such as DNA sequencing and gene cloning, are speeding up
the reality that this highly controversial plant will continue to make an impact on human
societies for generations to come. This book covers advances and techniques on how to
grow plant tissue in vitro, genetically modify this tissue, and re-grow it in order to
produce a transgenic Cannabis plant. Anyone who wants to know what the future holds
for Cannabis sativa and marijuana should read this book.
! %!
1. The Botany of Cannabis sativa
Before explaining the features of plant biotechnology, it is important to have an
understanding about what parts of the plant may be genetically modified. Therefore, by
introducing some concepts in plant anatomy and physiology, this chapter serves as a
platform for how a biotechnology experiment may modify the Cannabis plant.
Within the great diversity of life there exists the plant kingdom. This kingdom covers a
vast array of different species, some used by humans and others not yet discovered or
their potentials unrealized. The plant kingdom is unlike the animal and fungi kingdoms.
Plants make their own carbon compounds, such as sugars and starches, through their
ability to perform photosynthesis. They do this via intricate biochemical machinery that
has developed through more than 2 billion years of evolutionary forces.
The evolution of Cannabis represents a fascinating phenomenon. Early in the evolution
of life on earth, some floating cells in the ocean swallowed tinnier cells. This lead to the
theory of endosymbiosis, which states that these prehistoric larger cells were unable to
digest the smaller cells they had engulfed (Reyes-Prieto et al., 2007). This process
explains why plants have both chloroplasts (for photosynthesis) and mitochondria (for
respiration). Both of these organelles are easily observed with any compound microscope
and represent living proof of the past event of endosymbiosis.
This timeline shows that Cannabis is thought to have first arisen about 34 million
years ago based on work by McPartland and Nicholson (2003).
Thus, evolutionary change through time has pushed plants, like other organisms, to
become very efficient in their environmental interactions. Plants stand out from other
organisms not only because they do photosynthesis, but also because they have a cell
wall with depositions of cellulose, an incredibly large carbohydrate that functions like
rebar in concrete slabs. This is one reason that plants were able to make the transition
from water to land; they had better cellular structures (i.e., a rigid cell wall) to hold
themselves upright. The development of lignin, the compound that gives wood its
characteristic strength, came later in evolution and gave plants an added benefit for living
on land.
However the fundamental distinguishing characteristic, which sets plants apart from all
other organisms, is their alternating life cycles between a diploid sporophyte and a
! &!
haploid gametophyte. Diploid means that an organism has two copies of each
chromosome and haploid means it has only one copy of each chromosome. These
alternate between the organism and its reproductive cells. Hence, plants have an
alternation of generations. The large pine that might be observed in a city park or a
neighbor's front yard is the diploid spore-bearing generation. The pollen you see in the
spring is the haploid gametophyte.
With this considered, the Cannabis plant is a sporophyte that releases gametes, which
includes the pollen. When pollen is released its main objective is to fertilize the ovule,
which upon fusing together, yields a diploid embryo. Wondering how plants to new areas
then, it follows that the marijuana embryo develops into a mature storage capsule (a seed)
that can be transported by birds, or in some cases, the postal service. This is, of course,
with the gracious assistance of seed companies.
The plant kingdom is nicely divided into many subdivisions, but perhaps the most
important one to many plant taxonomists is the family level. Plant families include the
sunflower family (Asteraceae), the bean family (Leguminosae), and the grass family
(Poaceae). There are more than 300 plant families but the one we will concern ourselves
with, at least in this book, is the hops and cannabis family (Cannabaceae).
Domain Eukaryota Eukaryota
Kingdom Planta Animalia
Phylum Angiosprems Chordata
Class Dicotyledones Mammalia
Order Cannabales Primates
Family Canabaceae Hominidae
Genus Cannabis Homo
species C. sativa H. sapiens
!"#$%&'(")*"+*,"-*#%&'./%)%*%)0*,/#%)(*%&1*$2%310*%33"&0')4*5"*3/&&1)5*
6'"2"4'3%2*32%(('+'3%5'")7
The Cannabaceae family is composed of two genera. Humulus, the plant used for making
beer taste “hoppyâ€, has two species within its genus. The genus Cannabis has only one
species C. sativa. However, this has been greatly debated. Some researchers argue that a
second species originating in India (C. indica) is a valid species. Others content that C.
indica is a subspecies and should be treated as a variety rather than an independent
species. Years ago, the wild type variety of hemp was referred to as C. ruderalis. The
origins of Cannabis have been examined using genetic tools (Mukherjee et al., 2008).
! '!
Because much of the debate continues on how many species of Cannabis exist, we will
leave it to rest for the time being.
One reason Humulus and Cannabis are placed in the same family is that hops and
marijuana both grow in similar sexual morphs. They are dioecious plants, which means
they have separate male and female flowers. Dioecy occurs in ~5% of flowering plants
(Thomson, 2006).
Nearly three-fourths of flowering plants have perfect flowers, due to having both male
(stamens) and female (pistil) parts within the same flower. Strangely, Cannabis and a few
other plants are outside of this normalcy; their male and female flowers grow on
completely separate individuals (i.e., they have imperfect flowers). Because there is a
male plant and a female plant, out-breeding (exchanging genetic material between nonrelated
individuals) is maximized, and may be seen as an evolutionary advantage because
it allows for more genetic diversity.
The female plant is what marijuana smokers are most interested in, unless they are
sexually propagating a new variety. The male plant is interesting too, from an
economical, environmental, and agricultural perspective. Indeed, many books have been
published on hemp (Robinson, 1996; Herer, 2000; Conrad, 1997). However, only a
limited number of governments have realized the strength of hemp fibers and have
subsequently allowed industrial production. China is by far the largest producer of hemp
in the world today (Wang and Shi, 1999)
Hemp is not considered to have large amounts of resin, the material that contains the
psychoactive compounds most breeders desire. Resin, a sticky and chemically complex
substance, is often secreted through glandular trichomes on Cannabis leaves and flower
surfaces. There are two basic types of trichomes, glandular and non-glandular. Nonglandular
trichomes, in most species, are small, hair-like projections of a modified
epidermal cell that have evolved to restrict water loss from the leaf's stomatal pores,
which function similarly to the pores in human skin (i.e., they regulate internal
temperature). Although stomata often serve to transpire water vapor from the organism
and thus, facilitate a cooling effect, the plant eventually loses this water to the
atmosphere. The process of transpiration also helps distribute soil ions, water, and
nutrients through the plant. When plants lose water they eventually need additional water
at a later time for growth and cellular processes. Therefore to reduce this loss, nonglandular
trichomes help retain at least some of the plant's water before it leaves the
stomata. Often plants that are adapted to arid or dry habitats are covered with nonglandular
trichomes.
Most important to Cannabis cultivators are glandular trichomes. These too are modified
epidermal cells but function in secreting resin. There are many functions of the resin.
Some have asserted that it aids in capturing pollen, however there is presently no research
that supports this belief. It seems more logical, and in fact has been correctly asserted,
that resin plays some role in attracting pollinators for the flower (Armbruster, 1984).
! (!
For example, if the female Cannabis is kept free from pollination, glandular trichomes
will secrete more resin. The subsequent resin production attracts pollinators through this
method. The sticky resin secreted by the glandular trichomes continues production as
long as pollen is prohibited from landing on the stigma. Subsequently, this is the reason
that many Cannabis growers seek to prohibit male plants from interfering with
pollinating their female plants. That is, keeping males plants out of Cannabis gardens
increases resin production in female plants.
When pollen is used it is often in the form of a controlled crossing experiment. Crossing
different plant species is difficult because the pollen grain has exterior surface proteins
that must match up with a genetically compatible female stigma of the same species,
similar to key fitting into a lock (it simply occurs on a molecular level). The stigma,
which is the top part of the pistil that the pollen lands on, also has recognition proteins on
its surface. Sometimes this method is faulty and different plant species by mistake
successfully interbreed, although this is a rare event.
*
8*59$'3%2*+2"-1&*:2'29;*-'5,*6&%35(*2%612107*<,1*"=%&9*"5*(,"-);*'(*%5*5,1*6%(1*
%)0*%2")4*-'5,*5,1*(5'4#%*%)0*(5921*3"#$&'(1(*5,1*+2"-1&>(*$'(5'27*
Many genes control resin production. However many genes also control the genetic path
for plant development. Flowers are no exception to this and many genes have been
! )!
identified that play a role in the flowering process. The most popular model for flower
development is known as the ABC model (Soltis et al, 2007). This is based on the fact
that there are four whorls in a typical flower. The first whorl is the sepals. The petals
make up the second whorl and as one travels towards the center of the flower the next
two whorls are the stamens (male parts) and pistil (female part), respectively. The flowers
of Cannabis are interesting in themselves in that they lack petals but have retained their
sepals. Collectively, the sepals are termed the calyx and it is the calyx that surrounds the
fruit. Within the plant kingdom, various types of fruits exist, the description of which, is
beyond the scope of this botanical overview. Suffice it to say Cannabis produces a fruit
called an achene, where the seed and pericarp (outer fruit wall) are attached at the
funiculus (small stalk).
<,'(*(,"-(*5,1*6%('3*$%&5(*"+*%*59$'3%2*+2"-1&7*<,1*$10'312*+/)35'")(*%(*5,1*
(5%2?*"+*5,1*+2"-1&7*@'++1&1)5*$2%)5(*,%=1*1="2=10*0'++1&1)5*('A1(*%)0*)/#61&(*
"+*1%3,*$%&57*B"&*1C%#$21D*%*!"##"$%&*+2"-1&*2%3?(*$15%2(*%)0*/(/%229*,%(*#%21*
5%#1)(;*%)0*+1#%21*:$'(5'2;*$%&5(*")*(1$%&%51*$2%)5(7
! *+!
In many cases, transcription factors are needed to give the signal for turning a DNA
sequence into a functioning protein. The ABC model describes transcription factors,
which are proteins that act like an on/off switch for the genes that allow development of
flower parts. The exact function of the A, B, and C transcription factors has been
determined through creating mutated plants that have lost various functions of each of
these genes. By carefully tracking the mutational defects and the associated observable
trait, the function of each gene has been deciphered. Transcription factors for floral
development are normally initiated by alternating periods of light and dark, called the
photoperiod.
Transcription factor Parts encouraged to grow
A Sepals and petals
B Petals and stamens
C Stamens and carpels
E1)1*&14/2%5"&(*')="2=10*')*5,1*8F!*#"012*"+*+2"-1&')47*G%3,*5&%)(3&'$5'")*
+%35"&*'(*%*(#%22*$&"51')*5,%5*%35'=%51(*"5,1&*41)1(D*(5'#/2%5')4*0'++1&1)5*
+2"-1&*$%&5(*5"*01=12"$7*
!
Photoperiod has been shown to play a crucial role in plant flower development. Indeed,
this is a primary reason Cannabis continues vegetative growth in a light cycle of 14-16
hours. During the vegetative stage most indoor Cannabis growers keep their plants on a
long light cycle, in some cases the lights are never turned off. When the light is decreased
to 12 hours or less key signaling events occur within the plant that trigger the ABC
transcription factors that allow up-regulation, or turning on, of flowering genes.
With the diversity of plants on earth (~280 million species) it is a well-grounded
assumption that each plant species has evolved to respond in a slightly different way to
varying photoperiods. This partly explains the diversity in strains that have the ability to
flower early or late. Still, the ABC model of flowering applies to nearly all plants.
There also exists within Cannabis and other plants a protein called cytochrome (Bou-
Torrent et al., 2008). Cytochromes are protein molecules that harbor a chromophore, a
color-absorbing molecule. Depending on the wavelength of light striking the plant
surface, the phytochromes are converted between different states or forms. When the
phytochromes receive red light (660nm) they become the Pfr type, which is active and
allow flowering to proceed. If far-red light (730nm) is detected the phytochrome becomes
the Pr type. The Pr type is a biologically inactive form and so flowering cannot proceed.
An indoor gardener can use this principle to initiate flowering even in a light cycle of 14
or more hours. During the dark period of a plant's life, they can be given a brief pulse of
red light. This changes the Pr type into the Pfr form and allows flowering to begin.
Interestingly, these same phytochrome proteins play a crucial role in seed germination.
! **!
For instance, the Pfr form of phytochrome allows germination to proceed. Therefore, if
one is having difficulty germinating recently purchased Cannabis seeds, they should try
exposing them to a short period of red light before planting them.
Transcription factors and cytochromes are still just part of a larger system within the
plant cell. Plant hormones are another important part of Cannabis development and
biochemistry and play a crucial role in its genetic modification. There are five prominent
classes of plant hormones, which include auxins, cytokinins, gibberellins, ethylene, and
abscisic acid. An imbalance in any of these can cause strange morphologies within a
plant (Robert-Seilianiantz et al., 2007). The hormones all act as chemical regulators of
gene expression and thus, guide development and the morphology (observable shape) of
Cannabis. After all, the word hormone means “to set motion toâ€.
Indole-3-acetic acid (IAA) and 2,4-dichlorophenoxyacetic acid (2,4-D) are perhaps the
most widely known auxins. The amino acid tryptophan is enzymatically modified to
produce indole-3-acetic acid. Auxins are commonly found in developing leaves and
seeds. They function to control apical dominance, which is cell division at a terminal bud
or stem. They also play an important role in stimulating flowering and fruit development,
stimulate adventitious roots (growing from the stem) in asexual cuttings (clones), and can
induce ethylene synthesis.
Cytokinins also have many identified structures, perhaps the most common one in plants
is zeatin. Cytokinins are synthesized in the roots and are moved through the xylem to the
shoots to regulate mitosis. Artificial application can induce lateral buds to branch.
Cytokinins will be discussed later due to their important role in culturing Cannabis in
vitro. Cytokinins can also cause a delay in leaf senescence.
Gibberellins were used early on in plant experiments. They elicit perhaps one of the most
dramatic effects on a plant. If two plants are grown in separate pots, side by side and
gibberellins are applied to one plant, that plant will grow several magnitudes taller than
the other. Gibberellic acid is one of the most important and common gibberellins in
plants. Gibberellins are produced from mevalonate, a precursor in synthesis of terpenes (a
class of plant metabolites). They are found in immature Cannabis leaves and seeds. In
most species gibberellins help in elongating shoots and regulate some seed enzymes,
which are proteins that speed up a reaction.
Ethylene (C2H4) is a gas, which functions as a plant hormone. The amino acid methionine
is the precursor, which leads to formation of ethylene. Because ethylene is a small
molecule, it can easily move from cell to cell via diffusion. This hormone gave rise to the
old adage that one bad apple can spoil the whole bunch. Ethylene is most well known for
hastening fruit ripening. When tomatoes are picked and shipped, they are green. Just prior
to arrival at the grocery store the tomatoes are sprayed with this gas, ripening and
reddening the tomato fruits.
Like gibberellins, abscisic acid is also synthesized from mevalonate. It is an important
regulator of stomates and plays a role in seed dormancy. By applying abscisic acid to
! *"!
seeds, they can be kept dormant for shipping, so as not to allow them to mistakenly
sprout.
It should be noted to the reader that only a basic introduction to plant hormones is
provided here. For example, there are additional classes of plant hormones, but limited
knowledge exists on their synthesis and function. These include jasmonates, systemin,
salicylic acid, and the brassinolides. For the purposes of this book, the focus will be on
auxins and cytokinins, since they are used in plant biotechnology.
In Cannabis tissue culture, auxins and cytokinins are used to control root and shoot
formation of a young tissue growing in vitro. From a scientific view it is interesting to
know how Cannabis plants are growing and being maintained within their cells.
Hormones regulate nearly every response and function within the marijuana plant. Most
importantly, because many synthetic hormones are available for anyone to purchase,
experiments with Cannabis and any of these plant hormones can easily be performed by
anyone with a basic understanding of plant biology.
When flowers appear on the plant, more energy is delivered into the flower cells rather
than the vegetative cells. Plants in nature start to lose their flowers and begin seed
production each season when their genetic makeup interacts with environmental cues.
These cues are signaling events that prepare the flower for seed production, seed
maturation, and eventually plant death (annuals) or dormancy (perennials).
The plant roots are important in taking up minerals, ions, and water. There exist small
root hairs on the roots to increase surface area. Therefore, when transferring Cannabis
plants from one container to another, one should be very cautious to keep the soil-root
interface in tact. Disturbance of this interface diminishes the capability for the plant to
take up its needed supplies for metabolism.
Polymer Monomer(s) Example
lipids fatty acids, glycerol cell membrane
proteins amino acids THCA synthase
carbohydrates monosaccharide glucose
nucleic acids
nucleotide bases, sugar,
phosphate
DNA, RNA
H%3&"#"213/21(*"+*2'+1*0'='010*')5"*5,1'&*#")"#1&*(/6/)'5(*%)0*
&1$&1(1)5%5'=1*1C%#$21(7
Metabolism includes both breaking down materials (catabolism) and building materials
(anabolism). These processes are needed to construct new cells and cellular structures
such as organelles (e.g., mitochondria and chloroplasts). Cellular structures are either
! *#!
made up of lipids, proteins, carbohydrates, or nucleic acids. Each of these four large
molecules necessary for life is found in every living organism and vary in their
arrangement and concentration. Each is also a polymer (multiple units) composed of
smaller monomers (single units).
Light gives plants the ability to make their own food through the process of
photosynthesis. The chromophore (absorbing pigment) in plant chloroplasts that captures
light is chlorophyll. This molecule absorbs strongly at the red and blue ends of the visible
light spectrum. This spectrum represents part of a larger electromagnetic spectrum. Since
energy travels in waves, this spectrum is divided according to its wavelength. Visible
light ranges from ~400-700 nanometers (nm), where one nanometer is a billionth of a
meter. That's pretty damn tiny! Plants have a difficult time using wavelengths in the
middle of the visible spectrum (~500nm), which is reflected and seen by most humans as
the color green.
Perhaps the most important and familiar structure in the Cannabis plant is the nucleus.
This is the organelle that houses the DNA. Cannabis has twenty chromosomes and is
diploid. This means that it has two copies of each chromosome. By comparison, humans
have 23 chromosomes and are diploid. Genes along the DNA strand code for the proteins
that direct cellular development, flower development, etc. This is discussed in more detail
later, since it deserves its own chapter.
All of these botanical features and how they relate to Cannabis have not been described
in vain. They serve as a platform for the remainder of this book and facilitate a robust
background to host extending ideas on the genetic modification of Cannabis.
! *$!
2. Plant Biotechnology
In many ways plant biotechnology first began when humans initiated cultivating and
genetically crossing varieties of plant species to intentionally produce desired results. For
example, imagine a human ten thousand years ago collecting the pollen from a wheat
plant that was slightly taller then the other wheat plants then dusting this onto the female
flowers of other wheat plants. Over many years of collecting and dusting pollen from the
tall offspring and putting this pollen onto more wheat plants, most of the wheat plants
would be tall.
Nearly every crop food eaten today, including tomatoes, rice, potatoes, corn, barley,
apples, etc., all began as very strange looking varieties of undomesticated plants
thousands of years ago. Only when people recognized that there were patterns of
inheritance did they begin spreading select genes to other plants. Although the primitive
state (short height and small fruit size) of food crops offered our ancestors some gain in
nutrition, the capability to produce more food (taller height and large fruit size) has been
constantly pushed to the limits. Recent gains in realizing the genetic components of crop
species has led to a broader understanding of how foods have been improved over time
(Vaughan et al., 2007).
In fact most scientists today have optimistic views on food production. With
biotechnology there are few limits as to what sort of food can be grown. This means the
boundaries of plant genetic manipulation are still expanding. Biotechnology today is what
applying pollen onto flowers was for humans thousands of years ago. It has allowed our
species to gain larger yields of food on smaller areas of land.
The same basic ideas and patterns of inheritance of crop production have been applied to
marijuana plants. It logically follows that biotechnology should also be applied to
Cannabis crops. There are many benefits that biotechnology can offer Cannabis growers,
whether they are indoor or outdoor growers. The details of how this can be accomplished
are fairly basic but require a fundamental understanding of plant biotechnology to at least
have an intelligent conversation or carry out a reliable experiment. As stated by Albert
Einstein, imagination can be more powerful than knowledge. However imagination is
cultivated more easily through concepts of knowledge, making both imagination and
knowledge necessary for maximum progress.
One of the most fundamental components of plant biotechnology is the ability to
introduce foreign genes. Most high school students have seen the image of a glowing
tobacco (Nicotiana tobaccum) plant. This marked an important event in plant
biotechnology in that it stimulated public interest and created a deeper curiosity for plant
transgenics. Prior to fluorescing tobacco, people in the United States were introduced to
the Flavr Savr tomato, one of the first genetically modified foods introduced to
consumers (Marks, 2007). Boasted as having a longer shelf life in grocery stores, the
Flavr Savr tomato had little taste and left little to savor. This transgenic tomato remained
a poor seller on the market and so was pulled from shelves and discontinued.
! *%!
Among the agricultural industry, perhaps the most popularized gene that has been
introduced to plants is the gene that produces an insect toxin (Romeis et al., 2006). The
toxin, called Bt, is only toxic to certain insects and has no negative effects on humans.
Insects and humans have different proteins lining their digestive tracts. It was one of
these proteins to which the Bt toxin could bind to in insects. Humans lack this protein in
their digestive tract, and thus the toxin cannot bind and disrupt metabolism the way it
does in insects. This was the main reason it was allowed into corn plants. Researchers
subsequently found that insects avoided eating transgenic crop plants with the Bt gene, so
the plants were able to be grown without pesticide or stress from insect infestations. This
provided a huge savings to farmers who were commonly spraying their fields with
expensive pesticides. It also reduced the amount of chemicals going into the croplands.
In another example, quite different than the Bt gene, researchers have put genes into
plants that made them resistant to pesticides, which also grabbed the attention of the
agriculture industry. To give a specific example, the herbicide called glyphosate
(Roundup) kills plants but does not harm animals. Roundup kills plants by inhibiting a
metabolic pathway that only plants have (the pathway to make aromatic amino acids). So
when scientists put the Roundup resistance gene into crop plants, they gave it resistance
to the herbicide. When farmers sprayed with the Roundup pesticide, they did not kill their
crop plants. Instead, all other plants that did not have the Roundup resistance gene died,
including petulant weeds and unwanted invasive plants. The result was a happy crop
plant with no weedy competitors. This biotechnology advancement was so successful that
soybean and corn with Roundup resistance gene are now the most abundant transgenic
food crops grown in the US.
The US has been quick to embrace transgenic crops. Other countries have not been so
quick. At least part of this is due to the work of environmental groups such as Green
Peace, who is strongly opposed to GM (genetically modified) crops. Groups such as
Green Peace argue that some of these genes that are put into the plants can behave in
unpredictable ways. For example, suppose a person were to plant transgenic corn that had
the Roundup gene. Since all corn releases pollen during its flowering stage, that pollen
carries the gene for Roundup resistance. If the pollen with this gene were to then become
incorporated into a weedy or invasive plant species, there may be some concern. Imagine
a farmer that uses Roundup corn and then when they go to spray to kill the weeds, they
find that the weeds will not die; they have acquired the resistance to the pesticide. It has
been argued that the accidental incorporation of the resistance gene may produce such
“super weedsâ€.
Groups such as Green Peace often give both of these scenarios; transgenic Bt crops
killing beneficial insects or herbicide resistance genes being incorporated into other
plants to make “superweedsâ€. The process of genes migrating from genetically modified
plants into other non-genetically modified plants is known as gene pollution. Certainly
genetic pollution of the environment should be a concern. The emergence of transgenic
weeds that are resistant to an herbicide is not desirable by either the farmers or the
corporations selling the herbicides. In fact, preventing weedy plants from acquiring the
pesticide resistance genes is a major goal of agricultural biotechnology industries. This is
! *&!
because they have a vested interest in assuring that their pesticide continues to retain its
effectiveness.
Arguably, genetically modified crops need more research in order to understand their
complete role and influence on the natural environment. However, many countries have
moved ahead, confident that genetically modified crops are the best way to obtain food
and other raw materials such as cotton. Based on current statistics the United States is by
far the largest producer of transgenic crops (James, 2005). Argentina, Brazil, Paraguay,
and Canada are the next largest producers. Cotton is the most common transgenic nonfood
crop while soybean is the largest transgenic food crop (Stewart, 2008).
The great majority of plant genetic research and information on plant biotechnology in
the last few decades was aided with a small mustard plant called Arabidopsis thaliana.
Many researchers like Arabidopsis because it offers a short life cycle of about six weeks
from seed to maturity, is easy to grow, is small and therefore easy to work with, and has a
small genome (~157 Mbp) (Johnston et al., 2005). An organism's genome is the complete
set of genes, which all reside on the chromosomes, that it posses. Arabidopsis has served
as a model organism quite well, so well in fact, plant researchers around the world use it
for genetic, developmental, and evolutionary studies.
<,1*#"012*$2%)5*'("$%)*+&%&,-."/%"#"7*<,'(*(#%22*#/(5%&0*$2%)5*'(*/(10*
1C51)('=129*')*41)15'3*(5/0'1(*+"&*/)01&(5%)0')4*5&%'5(*"+*5,1*$2%)5*?')40"#7
There has been a wealth of information from this little mustard plant. Fortunately, much
that has been learned from Arabidopsis can be applied to Cannabis. There are many
genes that have been identified in Arabidopsis that are now waiting to be found in
! *'!
Cannabis (see Appendix A). Once these genes are found in Cannabis (called homologous
genes), they can be manipulated and induced to have a higher expression rate or knocked
out of the plant altogether. The result will be a plant of almost any form, with any trait
desirable. These genes are more exciting than the genes that stop insect damage or
provide herbicide resistance. In fact, the most difficult part of genetically modifying
Cannabis is going to be deciding on which gene to manipulate! The process of creating a
transgenic plant can often be tedious and time consuming. Fortunately, there only needs
to be one person to make transgenic Cannabis plants and then the seeds can be shared
with others. Regardless, it is important to understand the process of making a transgenic
Cannabis plant.
! *(!
3. Plant Tissue Culture
Tissue culture is a method where living tissue is sustained apart from an entire organism.
It allows for growing organs (i.e. roots) or cell masses in vitro, which literally means, “in
glassâ€. This requires the tissues be placed on a special growth media that contains all the
necessary ions and sugars to sustain its growth and energy needs. This is called plant
tissue culture. Fortunately for plant biotechnologists, plant tissues grown on this type of
media are also very susceptible to taking up foreign DNA. This is how transgenic plants
are often created.
Plant tissue culture has emerged as a way to genetically modify crop plants; hence many
techniques are available for specific species (Smith, 2008). There are three wellunderstood
methods for delivering a foreign gene into a plant. These are the floral dip,
the gene gun, and the bacteria, Agrobacterium tumefaciens. Each has advantages and
disadvantages and varies in use among institutions and researchers.
The floral dip is the easiest way to insert a foreign gene. When Arabidopsis is flowering,
it can be dipped upside down into a liquid broth culture of Agrobacterium.
Agrobacterium is a special type of bacteria that is able to transfer its DNA to the plant
(discussed more later). This means that some of the Arabidopsis flowers will be infected
with the Agrobacterium DNA. The floral dip is most commonly performed only with
Arabidopsis. Limited information exists on its efficacy on other plants. Considering the
size that Cannabis can become, this method may not be desirable. However, empirical
research is needed before this claim can be justified.
The second mode of introducing genes into plants is through the use of a gene gun. This
is a device that shoots microscopic metallic beads that are covered in a gene. The metal
beads are shot at a high enough velocity into a living plant so that some of the beads
penetrate the plant cell nucleus and the genes on the beads are incorporated into the plant
genome. The device costs a fortune (~15,000USD) and is therefore not used by the
majority of labs.
Perhaps the most pragmatic and cost-effective method of introducing a gene circles
around plant tissue culture. This method of plant transformation has proven to be quite
useful for many different species of plants. Although it takes many months from the start
tissue culture to the final product of a genetically modified plant, the method is very
affordable and most labs can accommodate the technical requirements. This method is
also the oldest of the three gene delivery methods, having its beginnings in the early
1900's in Germany from work by Heldebrant (Thorpe, 2007).
Successful transfer of a foreign gene using plant tissue culture depends on a bacterium
known as Agrobacterium. The way Agrobacterium works is described in the next chapter
so will not be discussed in detail here. For now, it is important to know some plant
physiology pertaining to plant tissue culture.
! *)!
Plants have a meristematic region where cell division is actively occurring. The meristem
is similar to the stem cells of humans in that they can divide many times. This tissue also
has what is called totipotency, which is the ability to divide and develop into any plant
cell type. Tissue culture takes advantage of meristems by allowing the researcher to grow
a piece of stem on sterile growth media, which supports the meristematic tissue's
nutritional and energy needs.
,-./0!123450215!6-.7!./!416830./0!38-2!4/!/80!8/-7!94802:;/8-8<7!9=0!.-58!6-./0!
948-8<7>!?;252!.32.5!@40;4/!6-./0!0455=25!.32!:8118/-7!A8=/B!8/!0;2!0465!83!50215!
./B!38805>!,23;.65!0;2!1850!A.14-4.3!0762!8A!12345021!45!.60-7!:.--2B!0;2!.64:.-!
12345021>!C64:.-!5416-7!32A235!08!0;2!-8:.048/!8A!0;2!0455=2D!40!45!A8=/B!8/!0;2!6-./0E5!
.62F!G83!2/B5H>!I4J4B4/<!:2--5!@40;4/!0;2!3880!.64:.-!12345021!.32!@;.0!.--8@!0;2!
6-./0!3880!08!<38@!A.30;23!B8@/!4/08!0;2!584->!K414-.3-7L!0;2!5;880!.64:.-!12345021!
.--8@5!A83!J2304:.-!<38@0;L!83!0.--/255L!8A!0;2!6-./0>!M;2/!!"##"$%&!2-8/<.025!405!
38805!./B!5;8805!0;2!.64:.-!123450215!.:0!.5!<=4B4/<!A83:25>!
C/80;23!12345021.04:!32<48/!45!N/8@/!.5!0;2!-.023.-!12345021>!M;4-2!0;27!.32!
5414-.3!4/!;.39834/<!.:04J2-7!B4J4B4/<!:2--5L!-.023.-!123450215!B4AA23!A381!.64:.-!
123450215!97!638J4B4/<!-.023.-!<38@0;>!?;2!:2--!B4J4548/!45!8::=334/<!O=50!=/B23!0;2!
6-./0E5!264B231.-!0455=25!.-8/<!50215!./B!93./:;25L!;2/:2!40!4/:32.525!0;2!0;4:N/255!
8A!0;252!6.305>!P83!4/50./:2L!-.023.-!123450215!4/!!"##"$%&!<4J2!0;2!6-./0!50=3B4/255!
./B!.94-407!08!;8-B!-.3<2!A-8@235!-.023!4/!405!-4A2!-2>!Q.//.945!<38@235!@;8!;.J2!
52-2:02B!A83!4/:32B49-7!-.3<2!9=B5!8A02/!B25432!0;4:N!-.023.-!123450215!4/!83B23!08!
N226!0;243!6-./05!A381!A.--4/<!8J23>!
R23450215!.32!;8318/.--7!:8/038--2B!97!.=F4/>!?;232A832L!:;./<4/<!0;2!6-./05!.=F4/!
-2J2-5!4/J8-J2B!4/!54</.-4/<!.AA2:05!405!12345021.04:!32<48/5>!?;2!.=F4/!.:05!-8:.--7!8/!
0;2!.64:.-!12345021!97!4/B=:4/<!:2--!B4J4548/!9=0!@;2/!40!03.J2-5!08!80;23!9=B!
32<48/5L!0;2!.=F4/!4/;49405!0;21!A381!<38@4/<>!S/!0;2!32.-1!8A!6-./0!6;7548-8<7!0;45!
12:;./451!45!:.--2B!.64:.-!B814/./:2L!./B!45!0;2!1.4/!32.58/!0;.0!6-./05!8A02/!<38@!
0.--23!0;./!@4B2>!SA!.!62358/!@.5!08!3218J2!0;2!B814/./0!.64:.-!12345021!G0;2!046!8A!
0;2!-8/<250!6.30!8A!0;2!1.4/!93./:;HL!-.023.-!9=B5!@8=-B!92!.--8@2B!08!B2J2-86!./B!
0;2!6-./0!@8=-B!0.N2!8/!.!9=5;7!.662.3./:2>!!
The lateral meristem is perhaps the most important meristem used in to plant
biotechnology. Again, this is because the lateral meristem that contains the totipotent
actively dividing cells. It is these cells that are allowed to grow on plant tissue culture
Petri plates.
*
! "+!
!
<-"*59$1(*"+*3/25/&1*#15,"0(*+"&*4&"-')4*$2%)5*5'((/1*')*='5&"D*%*5&%0'5'")%2*
I15&'*0'(,*")*5,1*21+5*%)0*%*H%41)5%*3/25/&1*6"C*")*5,1*&'4,57*<,1*H%41)5%*6"C*
'(*2'?1*%*5%22*I15&'*0'(,*5,%5*#%')5%')(*(51&'21*3")0'5'")(*%)0*%22"-(*=1&5'3%2*
1C$%)('")*"+*%*5&%)(+"&#10*$2%)57
Just prior to initiating tissue culture, a plant is diced along its stem and the pieces, called
explants, are placed onto tissue media. Conditions must remain sterile so that the stem
pieces are not contaminated with microscopic dust particles that often contain fungal
spores and bacteria. If improper technique is used and sterility is not achieved, fungal or
bacterial contamination will be obvious in several days to a few weeks.
Because sterility of tissue culture is of the upmost importance, the details of the technique
need to be described. First, it is highly recommended that the plant stem be young (4-5
weeks). The Cannabis seedling should also be grown indoors as the outdoor air is filled
with spores and bacteria that will easily cling to the surface of the cut plant. If this
happens contamination will be noticeable a few days after the plant has been diced and
placed onto culture media.
Collection of the stem should be carried out with a few simple tools. A small tweezers is
used to clasp the plant at the base. Similarly, one might prefer to gently pinch the top of
the plant to keep it steady. A scissors is used to snip the young plant at the base. Any
leaves that have developed are trimmed off. Careful attention is given so that at no time
will the stem come into contact with the soil or any surface. The final product should be a
! "*!
slender, and preferably straight Cannabis stem. This is placed in a sterile tube and
capped. After capping the tube the stem is ready to be lightly washed with a mild
detergent and 70% alcohol solution. These solutions can be directly added to the tube.
Washing is just as crucial as cutting and trimming the stem. If the wash steps are too
long, the plant cells will die. If the washes are too short, any microbial contaminants will
remain and fungus or bacteria will overrun the growth media. Therefore, a delicate
balance must be achieved to successfully wash the stem without killing the plant cells.
Generally, an initial wash with 70% alcohol (e.g., 3mL water and 7mL 100% alcohol for
a total of 10mL) is used with a drop of tween20, a mild detergent. The detergent is not
always necessary, but it does aid in working the alcohol into the grooves on the outside of
the stem. The tube is capped and shaken vigorously and allowed to sit at room
temperature for 5 minutes. The tube is washed with sterile water and a second wash is
implemented in the same fashion as the first wash but without the detergent. A final wash
with a 1% bleach solution (1mL bleach and 99mL water, using only 10mL of this) is
preferred in some tissue culture methods, however when dealing with stems obtained
from indoor-grown plants this may be superfluous.
Sterile water is used for a series of no more than ten rinses to guarantee that the alcohol
and bleach have been completely washed from the stem. The closed tube is placed in a
sterile laminar flow hood. If you do not have access to a flow hood, you can make a
sterile hood-like environment. I have seen these in a few of my friends' houses who do
experiments at home. However, biotechnology at home is its own endeavor and will not
be discussed in this book. Tissue culture media should be prepared ahead of time so the
stem can be carefully removed from the sterile tube, diced and placed onto the media.
! ""!
*
8*2%#')%&*+2"-*,""0*'(*/(10*+"&*-"&?')4*')*(51&'21*3")0'5'")(7*J51&'21*%'&*'(*
#"=10*0"-)*+&"#*5,1*5"$*%)0*"/5*"+*5,1*,""0*")*5,1*('01(*5"*%="'0*
3")5%#')%5'")*69*/)-%)510*+/)4%2*%)0*6%351&'%2*($"&1(7
Preparing the growth media for Cannabis is not as difficult as one may think. Many
companies sell a powder form of mixed micro and macronutrients, which is mixed with
water and sterilized.
There are two types of media commonly used in plant tissue culture. The first is called
callus media. This is because after placing Cannabis meristematic tissue on it, the
appearance takes on tissue formed over a wound. Because callus media is the first media
used in a plant tissue culture experiment and it forces the plant tissue to form a callus, the
media is aptly named callus initiation media.
The second type of media in plant tissue culture is used at a later stage in the process.
This growth media is called MS media. In the 1970's two researchers whose last names
were Murashige and Skoog developed this nutrient media (Murashige and Skoog, 1962).
Skoog was an undergraduate working in Dr. Murashige's lab when he discovered this
media. It is now called MS media in their honor. Both of these media types will be
explained in greater detail. For now, concern will be given to proper preparation of the
media.
! "#!
<,'(*5%621*(,"-(*5,1*')4&10'1)5(*')*HJ*#10'%D*-,'3,*'(*)11010*+"&*4&"-')4*5,1*
$2%)5*5'((/1*+&"#*%*)")K0'++1&1)5'%5')4*3%22/(*')5"*%*3%22/(*-'5,*&""5(7*
Name of Chemical Molecular Formula/Description
ammonium nitrate NH4NO3
calcium chloride CaCl2
magnesium sulfate MgSO4
manganese sulfate MgSO4
Potassium phosphate KH2PO4
ferrous sulfate FeSO4
zinc sulfate ZnSO4
potassium nitrate KNO3
potassium iodide KI
cupric sulfate CuSO4
boric acid` H3BO3
cobalt chloride CoCl2
sodium molybdate Na2MoO4
niacin a coenzyme
pyridoxine (vitamin B6) a coenzyme
ethylenediamine tetra-acetic acid acts as a metal chelator
inositol a sugar
thiamine a coenzyme
glycine an amino acid
indole acetic acid (IAA) root hormone
kinetin shoot hormone
sucrose a common sugar
agar solidifies media
! "$!
Callus initiation media and MS media can be ordered from most any web resource that
deals with biological supplies. As in all other growth media, the contents are shipped in a
dry state, so they must be weighed and mixed with the appropriate amount of deionized
water. Deionized water is important to use because chlorine and other ions in tap water
may interfere with the growth of the explants. After measuring the proper amount of
deionized water, the contents of the media mixture (water and dry media powder) are
stirred and autoclaved.
The autoclave is an oven-like chamber that reaches high pressure and temperatures. The
highest temperature most autoclaves reach is 121°C/250°F. Such high temperatures are
needed because boiling sometimes does not kills bacterial endospores, a type of survival
state used by some bacteria. Prior to autoclaving, agar is also added to the media mixture.
Agar acts as a solidifying agent when the media cools. This too is a powder and is
weighed, usually adding 15 grams per Liter of water. Upon adding and mixing all
ingredients, the opening of the flask or glass container must be covered with aluminum
foil.
! "%!
*
<,1*%/5"32%=1*'(*%*2%&41*"=1)K2'?1*3,%#61&D*-,'3,*'(*/(10*5"*(51&'2'A1*2%6*
1L/'$#1)57
After the mixture of water, plant nutrients and agar is autoclaved it is allowed to cool
inside a laminar flow hood. The laminar flow hood creates a negative pressure that aids in
! "&!
keeping the work area sterile. Above the working area, sterile air is blown down. The
flow of air is aided by perforations in the back of the hood and lower front part of the
hood opening that pull on the flowing air.
It is important to remember that the laminar flow hood is the only safe place for carrying
out any work that must be kept free from contamination. Petri dishes are often purchased
in bulk, so that media can be made on demand and MS media plates can be used when
needed. These Petri dishes are disposable, however reusable glass Petri dishes are
available.
J"#1*"+*5,1*6%('3*#%51&'%2(*)11010*5"*614')*!"##"$%&*5&%)(+"&#%5'")M*N;*
G&21)#191&*+2%(?D*O;*4&%0/%510*392')01&D*P;*HJ*%)0*3%22/(*#10'%D*Q;*%4%&D*R;*
$%&%+'2#D*S;*I15&'*0'(,1(D*T;*(3%21D*U;*5-11A1&(*%)0*(#%22*(3'(("&(D*V;*%)5'6'"5'37
Pouring plates is the method of removing the Petri dishes from a clear plastic sleeve,
making stacks of 4-5 plates (i.e., Petri dishes), and carefully opening them one at a time
(starting from the bottom of the stack) while pouring molten media into each plate. It is
one of the first techniques a new lab student learns. Only about 10-20mL of media is
needed for each plate, which is just more than enough to cover the bottom surface of the
plate. Callus media is used in the first part of the experiment, however these techniques
apply to MS media (used later in tissue culture) as well.
! "'!
?;2!12B4.!=52B!08!:=-0=32!:.--=525!8A!!"##"$%&!;.5!720!08!92!6=9-45;2B!4/!./7!
5:42/04A4:!O8=3/.->!T8@2J23L!.!32:462!0;.0!;.5!@83N2B!@2--!A83!1./7!6-./05!45!:.3380!
:.--=5!4/404.048/!12B4.>!K414-.3!12B4.!:./!.-58!92!=52B!A83!5;880!4/404.048/L!@;4:;!45!
:.--2B!:.3380!5;880!B2J2-8612/0!12B4.>!U80;!8A!0;252!:./!92!83B232B!8/-4/2!A381!
Q.38-4/.!U48-8<4:.-!K=66-7!G522!.662/B4F!UH>!?;45!:816./7!638J4B25!63214F2B!
6.:N205!8A!B37!12B4.L!@;4:;!:./!92!68=32BL!.-8/<!@40;!B37!.<.3L!4/08!.!V4023!8A!@.023>!
CA023!.=08:-.J4/<!0;2!;80!-4W=4B!12B4.!45!68=32B!4/08!0;2!,2034!B45;25L!.5!O=50!
B25:3492B>!!
The plates are then carefully lifted one at a time from the stack and laid out inside the
laminar flow hood in a grid-like fashion. As they are placed onto the surface of the flow
hood, the lids are slightly tipped to the side to allow the media to cool faster and excess
moisture to escape. During placement and movement of the plates containing molten
media it is important to not splash media onto the inside lid of the plate. If this happens, it
increases the chance for contamination when working with the plates at a later time.
When the plates have cooled the lids are tipped correctly back into place and they are
restacked into one column. The sleeve is placed back on top of them and they are covered
and the entire contents can be inverted and are kept refrigerated at 4°C/39°F. The entire
process of making media and pouring plates takes approximately 2 hours, although the
time is greatly reduced with practice.
Which brings us back to the sterile tube with the Cannabis stem. The tissue culture plates
with the media should be made the day before the stem clipping and washing steps. Prior
to preparing the stem, the sterile plates should be removed from the refrigerator and
placed inside the flow hood. Inside the laminar flow hood there should also be a small
sterile scissors and tweezers. These should both be autoclaved, usually wrapped in
aluminum foil, to guarantee their sterility, and then opened only in the flow hood. In fact,
these items can be autoclaved along with the media.
There should also be an alcohol dish and a flame. Before use, the ends of the scissors and
tweezers are dipped in the alcohol after which the alcohol is burned off. Keeping them
from touching any part of the hood, the stem is removed with the tweezers and held
steadily over an uncovered Petri dish containing tissue media. Small sections (1-2mm) of
the plant are clipped with the scissors and allowed to fall onto the callus media. Often,
latex gloves are used as a precaution to allowing skin cells or bacteria to fall onto the
plate.
When 5-15 pieces of stem have fallen onto the plate, the sterile tweezers can be used to
manipulate and move the pieces of Cannabis stem. They should be placed equidistant
from one another and gently pushed down to ensure complete contact with the media.
The lid can then be placed back onto the Petri dish. Parafilm, a stretchy plastic film, is
wrapped along the edge of the plate and its lid. This helps in retaining moisture and
keeping the contents sterile.
! "(!
The tissue cultures are put away from any disturbance and are kept at room temperature
(22°C/72°F). They do not need light. After a few weeks the bits of Cannabis stem will
slowly start to change into an amorphous aggregate of totipotent cells. This is called a
tissue callus and contains the genetic components of Cannabis, but has the distinct
quality of being able to develop into any plant organ (totipotency).
Plants, due to their meristematic regions, are unlike animals, which have stem cells, in
that they can be asexually propagated. Using conventional techniques in the laboratory, a
cat's ear could not be grown into a new cat because there is an absence of meristematic
cells. Additionally, complications would arise due to the nutrient and energy demands of
the cat ear. Plant tissue culture is unique in that it allows rapid production of clones of a
desired species with minimal demands required for the growth media.
When the calluses have grown into masses that lack resemblance to the original bits of
stem, they can be inoculated with a few drops of the infectious plant bacterium,
Agrobacterium tumefaciencs.
! ")!
4. Agrobacterium tumefaciens
Much progress has been gained in research through the fundamental understanding that
microbes (bacteria and fungi) are ubiquitous. Bacterial and fungal species are in the air,
water, soil, on all types of surfaces, and can thrive in the human body. Each species has
evolved the molecular machinery to sustain their energy and nutrient needs. For these
reasons they have often been looked at to provide potentially beneficial industrial
applications (Pontes et al., 2007).
In order to reproduce, bacteria divide in a process called binary fission. This creates two
identical offspring, sometimes in as little time as twenty minutes. Fungal spores often
take much longer than this to reproduce. Regardless, the power of microbes should be
respected. Although they are often only a few micrometers in length, they have the power
to overtake a body with a weakened immune system. They have the ability to feed on raw
sewage with glee and a small percentage even smile in the face of antibiotics. It should
not be a surprise, then, that bacteria have found a way to colonize and infect plant tissue.
If the outer epidermal tissue is pierced and the delicate tissue of the plant is exposed to
the outside air, bacterial infection might result. This is often seen on the crown of the
plant, which is the base where the trunk meets the soil. The crown is a likely point of
entry because it is dividing and growing to support the weight of the tree, therefore the
outer layers of tissue are prone to splitting. Among the billions of bacteria that have been
discovered and described is a species known as Agrobacterium tumefaciencs.
This bacterium has evolved the molecular machinery to infect plants in a very interesting
way. It lives in the rhizosphere, which is the area directly around plant roots, and enters
and infects the plant when an opportunity arises. Interesting research has shown that the
relationship between Agrobacterium and some plants involves complex signaling events
(Yaun et al., 2008). The result of this cross talk is what most gardeners call crown root
gall but a plant biotechnologist thinks of as an expected and welcomed tool of
biotechnology.
! #+!
<,1*6%(1*"+*%*5&11*5&/)?*-'5,*%&&"-(*$"')5')4*5"*('51(*"+*')+135'")*69*
'0(*$"1-2(%34*(,"-(*5,1*3,%&%351&'(5'3*?)"6(*:5/#"&(;7
Like other bacteria, Agrobacterium has a genome that contains nearly all its genes needed
for routine metabolism and growth. What makes this bacterium unique is that it has an
extra chromosomal piece of DNA about 200 thousand bases (kb) in size. This extra
chromosomal piece is technically referred to as a plasmid, and can come in various
lengths depending on the bacterial species. It is also important to note that plasmids are
often circular in shape. Interestingly, a part of the plasmid within Agrobacterium can be
transferred to the genome of a plant, thereby passing bacterial genes to a “higherâ€
organism.
! #*!
@'%4&%#*"+*%)*'0(*$"1-2(%34*$2%(#'0*"5*5"*(3%21;7
The ori region, shown on the plasmid above, stands for the origin of replication. This is
the sequence on the DNA that has a specific base sequence that allows for an enzyme to
bind and begin copying the plasmid. Remember, the plasmid DNA must be copied before
a cell divides. Therefore, the enzyme that polymerizes a new plasmid must be able to find
this ori region. The enzyme is (not surprisingly) called DNA polymerase because it is
polymerizes DNA.
Most importantly to Cannabis biotechnology, plasmids can also take up new pieces of
DNA. Consider any gene and call it your gene of choice (or if you can't think of one, see
Appendix A). This foreign gene can be first transferred to the plasmid, the plasmid
transferred to Agrobacterium, then the Agrobacterium transferred to a plant cell. This is
partly due to that when at the right size and stage, Cannabis callus cultures can be
intentionally infected with Agrobacterium containing the plasmid that contains your gene
of choice. Whew, now that's a mouth full! Now that your imagination is blossoming with
potential genes to insert, it is important to know some details on these mechanisms. The
! #"!
remainder of this book deals with inserting genes into plasmids, infection of calluses with
Agrobacterium, gene delivery (transformation), and maturing the callus cultures into an
adult transgenic plant.
There are many different strains of Agrobacterium that are available for purchase to
infect plant calluses. Different strains have various positive and negative aspects, such as
the ability to only infect a certain species or type of plant. Many of these strains can be
ordered directly from Internet companies (see Appendix B). Some strains are designed
with part of the transferred DNA (T-DNA), which is the DNA segment that gets
transferred to the plant. For example, the T-DNA might contain the gene that encodes for
a protein with the ability to fluoresce visible light. However, many other genes can also
be chosen for transferring to the Cannabis plant genome. Additionally, many other genes
are necessarily transferred to the calluses. For instance, notice that the Agrobacterium
plasmid has a small gene coding for an enzyme that breaks down the antibiotic
kanamycin. This will become very important later in the transformation process.
The transferred DNA (T-DNA) also contains sequences of nucleotides that code for
enzymes that make two important components that the bacterium will need to survive in
the plant cell (McCullen and Binns, 2006). The first set of genes is for enzymes to make
plant growth hormones, which confuse the plant into dividing and growing its own tissue.
This ultimately results in a crown gall, a knobby protrusion that provides a nice home for
the Agrobacterium. This is fascinating because what is happening is that the
Agrobacterium hijacks control of the plant cell and dictates to the plant cells on how to
grow.
The second set of enzymes on the T-DNA is for enzymes that synthesize opines, rare
amino acids that Agrobacterium needs in order to grow. Opines are so unusual that plants
do not have enzymes that recognize them and therefore, cannot use them. Only the
bacteria can use them, which provides an advantage. The total size of the T-DNA
transferred to the plant is about 23kb.
In addition, the Agrobacterium has regions on the plasmid besides the T-DNA region.
There is a virulence region that is ~40kb and codes for proteins that help guide the TDNA
into the nucleus of the plant cell. There is also what is called an origin of
replication, or ori region, which simply allows for plasmid replication. Although there are
many more regions of the Agrobacterium plasmid, we will concern ourselves with the TDNA
segment, since that is of the upmost concern for transforming Cannabis.
After infecting the Cannabis callus with Agrobacterium, the tissue is allowed to remain
in its Petri dish for two days. This is called co-cultivation and gives the Agrobacterium
ample time to infect the plant cells. It is during this time that the T-DNA is inserted into
the plant genome.
When the two days of co-cultivation have passed, the callus tissue is transferred to new
callus growth media. Again, working in the flow hood and sterile conditions are
necessary to keep microbes from landing on the growth media. The new growth media
! ##!
contains two antibiotics. One is to kill the Agrobacterium. This is important because
letting the Agrobacterium continue its growth on the callus will eventual result in plant
cell death. Since the T-DNA has had time to be incorporated into the Cannabis genome,
the death of Agrobacterium is of no concern. A common antibiotic used is timentin,
which kills the Agrobacterium, but has no effect on plant cells.
The antibiotics in the media are not only present to kill Agrobacterium, but also to select
for transgenic plants. Part of the T-DNA passed to the plant genome confers resistance to
kanamycin and if a plant cell has taken up the T-DNA it will grow on media that has had
antibiotic added. Antibiotics are added to warm media after removing the media from the
autoclave. The temperature of the molten growth media should not be more than
55°C/131°F so as not to destroy the molecular structure of the antibiotic.
Plant cells do not tolerate kanamycin and therefore it kills them. Only transformed plant
cells containing the kanamycin resistance gene can survive on the kanamycin antibiotic
media. It is the kanamycin that kills any non-transformed callus cells and allows for only
those calluses that have been genetically modified to survive. This helps in selecting for
only plant calluses that have been genetically modified for subsequent manipulation.
The calluses at this point in the transformation process are very brittle and resemble
small, rough-shaped pieces of soap. When squeezing them with a tweezers they will
easily break into multiple pieces. Sometimes this is desired; many pieces of callus will
lead to many plants. However, many plants may not be necessary, so it is up to the plant
biotechnologist to decide how to distribute the calluses onto the new media.
! #$!
!%22/(1(*4&"-')4*")*I15&'*0'(,*-'5,*3%22/(*#10'%*-'5,*?%)%#93')*%)0*5'#1)5')*
%00107*W)*5,'(*$,"5"D*XY*2'4,5*-%(*(,'))10*5"*')0/31*+2/"&1(31)31*')*"&01&*5"*
3")+'&#*5,%5*5,1*EBI*41)1*-%(*(/331((+/229*5&%)(+1&&107
To make sure all the Agrobacterium have died and only transformed plant cells remain,
the calluses are transferred every 7-14 days to a new Petri dish with callus media and the
two antibiotics (kanamycin and timentin).
After 4-5 weeks of this process the calluses can be transferred for a final time. They are
moved once again using sterile technique. This time each callus is placed on media that
has plant hormones imbedded in it in addition to the antibiotics. The hormones will tell
the calluses that it is time to differentiate into specific cells (leaves, roots, shoots, etc.).
Instead of a Petri dish a taller container with MS media (with hormones) can be used.
This taller container, called a Magenta box, allows for more area that the roots and shoots
will need to grow.
! #%!
I15&'*0'(,*-'5,*+/)4%2*3")5%#')%5'")7*<,1*%&&"-*'(*$"')5')4*5"*5,1*%0=%)3')4*
1041*"+*5,1*+/)4%2*3"2")9D*-,'3,*,%(*%2&1%09*(/&&"/)010*2%&41&*3%22/(1(*5"*5,1*
2"-1&*21+5*%&1%*"+*5,1*0'(,7
To help the calluses develop shoots and roots, a cytokinin (e.g., zeatin) is present to
induce shoot formation while an auxin (e.g., indole acetic acid) is present to induce root
development. These can be used in different ratios, depending on what is desired. For
example, a high auxin to cytokinin ratio favors shoot formation.
Choosing the correct auxin:cytokinin ratio is for the biotechnologists to decide and
depends on the species one is using in the experiment. In some tissue culture powders,
hormones are added, allaying any concentration or ratio concerns that the plant
biotechnologist may have. Manipulating plant hormones within the tissue media is the
underlying reason that a callus changes from being totipotent to initiating organogenesis,
or shoot and root formation. The Cannabis tissue cultures are placed under a suitable
grow light in order to allow the transformed calluses to begin manufacturing chloroplasts
used in photosynthesis.
In as little time as a month small points and protrusions will be seen on the Cannabis
calluses. These are the young shoots and roots beginning to emerge. The calluses are
allowed to continue growing on the MS media until their shoots and roots are at a healthy
size. They will still be very delicate at this point. Just prior to removing the young
genetically modified plants from the Petri dish or Magenta box, they need to be exposed
to the external air. To do this, the lid of the container is opened and air is allowed to
! #&!
circulate through passive diffusion. This process, which lasts about two days, also helps
in hardening the plants in preparation for much lower humidity levels outside of the Petri
dish or Magenta box.
I,"5"4&%$,*"+*3%22/(1(*4&"-')4*")*&""5*')'5'%5'")*#10'%*-'5,*%&&"-(*$"')5')4*
5"*01=12"$')4*&""5(7*J"#1*3,2"&"$,922*:4&11);*$'4#1)5%5'")*'(*%2("*$&1(1)57*
<,1*(#%22*&""5*,%'&(D*-,'3,*')3&1%(1*(/&+%31*%&1%*+"&*"$5'#%2*-%51&*/$5%?1D*
%&1*%2("*='('6217*<,1*')(15*$,"5"*'(*%)*1)2%&41#1)5*"+*5,1*&""5')4*3%22/(7*
It is important to consider that once the developing plants are moved to soil their organs
will have to sustain a young plant. Care should also be taken to minimize exposure of the
young plants to pests or harsh environmental conditions such as temperature fluxuations.
Therefore, before transferring the developing plants consider where they will be grown.
An indoor growth chamber with adequate light is necessary in nearly all situations of
plant transformation. This provides a steady, equilibrated environment with an adequate
light source. Most plant growth chambers allow for temperature, light and sometimes
even CO2 control.
! #'!
A Cannabis callus that has been genetically modified with the GFP gene is shown
growing in a Magenta box. When its roots, shoot and leaves have further developed,
it can be placed in soil and moved to a growth chamber.
If moving the transformed Cannabis to a greenhouse or an outdoor area, they need time
to slowly adjust. Small increases of time in exposure to less favorable conditions are
made gradually over several weeks. This is extra work and lends itself to possible plant
death, wasting many months of hard work. Therefore using a growth chamber provides
the best chance for keeping the transgenic Cannabis alive.
! #(!
*
8*&1+&'41&%5"&K('A10*4&"-5,*3,%#61&*/(10*+"&*4&"-')4*5&%)(+"&#10*$2%)5(*
-'5,*012'3%51*)1-*&""5(*%)0*(,""5(7
! #)!
*
8*(#%221&*4&"-5,*3,%#61&D*-,'3,*$1&+"&#(*1L/%229*-122*3"#$%&10*5"*5,%5*"+*
5,1*2%&41&*&1+&'41&%5"&K('A10*3,%#61&D*3%)*%2("*61*/(10*+"&*"$5'#'A')4*5'((/1*
3/25/&1*3")0'5'")(7
*
! $+!
*
B2"-*3,%&5*"+*!"##"$%&*5'((/1*3/25/&1*#15,"0*$&"4&1((')4*+&"#*5,1*"&'4')%2*
(51#*"+*5,1*!%))%6'(*$2%)5*5"*+/&5,1&*6&110')47*G%3,*(51$*(,"-)*,1&1*'(*"+51)*
(2'4,529*#"0'+'10*%33"&0')4*5"*5,1*59$1*"+*$2%)5*($13'1(*")1*'(*-"&?')4*-'5,7*
! $*!
5. The GFP Leaf
The simplest Cannabis transformation involves using Agrobacterium that has the green
fluorescent protein (GFP) gene in its T-DNA region. The GFP gene codes for a protein
that fluoresces ~500nm (green) wavelengths of light when exposed to blue light. In
respect to its size and relation to other protein molecules it is a relatively modest protein,
composed of only 238 amino acids. Agrobacterium that contains this gene (and an array
of other genes) can be readily purchased (see Appendix B).
Similar to the cytochrome discussed earlier, GFP contains a chromophore. The
chromophore has electrons that are excited by the blue light. Upon exposure to blue light
the electrons in the chromophore are elevated to a higher energy state. As they lose
excitation they release energy in the form of visible light, which is the cause of the
fluorescence. This brings us back to the concept of electromagnetic radiation, discussed
in the opening chapter. Visible light is a small part of a spectrum of different frequencies
of energy. High-energy waves have a higher frequency and a smaller wavelength. Low
energy waves of the spectrum have less energy and a lower frequency.
Gamma rays and X-rays are on the high-energy end of the spectrum while radio waves
are on the opposite end and have less energy. Visible light is somewhere in the middle of
these two extremes. At just a higher frequency than visible light is ultraviolet light, which
damages cells due to its high-energy nature. The colors on the visible part of the spectrum
can be divided into specific frequencies and have distinct wavelengths. Violet, next to
ultraviolet, is a higher frequency than red, while green is in between these two. An easy
way to remember the order of light and its frequencies is with the pneumonic, ROY G
BIV (red, orange, yellow, green, blue, indigo, and violet).
From knowing the colors and their associated wavelengths, understanding fluorescence is
straightforward. When something fluoresces it emits a lower energy color than the
incident, or incoming, wavelength that first strikes it. For example, shining a blue light on
something with fluorescent properties results in a lower energy wavelength of light being
emitted, such as green. The fluorescence itself arises due to an electron being
momentarily excited to a higher energy state and then falling back to a lower energy
state. The transition of energy states results in a particle of light (a photon) being
released. Humans see this as fluorescence.
The green fluorescent protein gene was first isolated from a jellyfish in the 1990's. It has
since found many uses in plant biotechnology (Sheen et al., 1995; Davis and Vierstra,
1998). Its main use is to act as a reporter gene. This means that when performing a plant
transformation experiment, the GFP gene can be attached to the T-DNA region of the
plasmid. This then allows for visual confirmation of a successful plant transformation
experiment. Green fluorescent protein has become so important in many experiments that
the discoverers of GFP were awarded the Nobel Prize in Chemistry in 2008 (Cantrill,
2008).
! $"!
Since its discovery the GFP gene has been inserted into many other organisms, including
animals. This has included making glowing fish (Danio sp.), and mice. Many pet stores
now sell GFP fish to put into home aquariums. Perhaps the strangest creation of all has
been the GFP pig.
Induced mutations of the GFP gene make a protein that emits slightly different
wavelengths of light. Available in the biotech market today, there exists a GFP reporter
gene that will result in a protein that fluoresces nearly every color of the rainbow.
Transforming these genes into Cannabis would result in a plant with colorful buds when
under a black light.
The pragmatical reasons for doing a Cannabis-GFP transformation are difficult to argue.
However, science is not just about pragmatism, it's also about discovery, exploration, and
excitement. When tobacco was first transformed with a firefly gene (that encoded for the
protein *******ase), everyone including the public sector as well as school kids were all
suddenly interested in how plant biotechnology might affect their lives. The same reasons
might be argued for creating a glowing Cannabis plant.
However, in some cases such as the creation of GFP mice was not simply for show. It
has, in fact, led to an important new method of studying brain function. Using different
variants of the GFP gene that emitted different wavelengths (colors) of light has allowed
scientists to study individual cells and differentiate between single neurons. Since brains
are often quasi-organized, but often with indiscernible entanglements, variation in neuron
color helps to distinguish individual neurons. Perhaps making a GFP Cannabis plant with
the same variety of fluorescence could lead to better viewing of the xylem and phloem.
The GPF experiments offer insight into how biotechnology provides advances in
knowledge and discovery. However, cutting a gene out of one organism and putting it
into another organism requires skill, proper knowledge and the proper lab equipment.
First, the experiment must be decided. The sequence of the gene of interest must at least
partially be known, which allows isolation and amplification of the gene. Second, a
potential organism to be transformed must be decided. Usually this is selected from a
choice of model organisms whose genome composition, ability to be transformed, and
growth conditions have been well established. Finally, one must then decide on the
vector, or the way that the gene will be transferred. We have previously discussed the
Agrobacterium plasmid as the vector for Cannabis transformation.
Inserting the gene into the chosen organism can only be done after the gene has been
ligated, or enzymatically linked, to a vector. Perhaps the most well established vector for
transforming plant calluses is the plasmid of Agrobacterium. Therefore, in order to
deliver the gene from Agrobacterium into plant calluses, the plasmid must be ligated to
the gene. Many molecular biology kits to carry this reaction out are commercially
available from a wide range of companies.
After ligation, the plasmid containing the gene can then be inserted into the
Agrobacterium in one of two ways. The plasmid with the ligated gene can be mixed with
! $#!
Agrobacterium cells and placed in a small tube called a cuvette. An electric shock is
given that forces the Agrobacterium to take up the plasmid. This process is known as
electroporation.
*
8)*12135&"$"&%5"&D*-,'3,*'(*/(10*5"*#%?1*'0(*$"1-2(%34*5%?1*/$*5,1*$2%(#'07*
<,1*/$$1&*21+5*3"&)1&*(,"-(*5,1*3/=15517*8+51&*$2%3')4*84&"6%351&'/#*%)0*5,1*
$2%(#'0*')5"*5,1*3/=1551D*5,1*3/=1551*'(*')(1&510*')5"*5,1*$"0*%)0*%*(#%22*$/2(1*
"+*12135&'3'59*'(*4'=1)7
Selection for transformed Agrobacterium can then be carried out on antibiotic containing
Petri dishes that only allow Agrobacterium that has a plasmid to grow. This is because
the plasmid will have an antibiotic resistance gene, as previously discussed.
The second way to make Agrobacterium take up the ligated plasmid is called heat shock.
In this method, the Agrobacterium and plasmid are mixed in a small tube. This mixture is
transferred from ice to a warm water bath, then back to ice. The cells are then spread onto
the Petri dish, much like after doing an electroporation reaction.
After growing the Agrobacterium on a Petri dish, some of the cells can be picked off with
a sterile wire and dipped into a broth (liquid) culture, which is a growth media similar to
the Petri dish but without the solidifying agar. This broth is allowed to grow for two days,
or until the Agrobacterium reach a desired cellular density.
! $$!
A few drops of the broth culture cells can be dropped onto plant tissue callus. By their
nature, they will infect the plant callus tissue and insert the genes from the plasmid (the
T-DNA). This is the basis of genetically transforming the plant cells. If so chosen, the
Agrobacterium that was grown in broth can be grown in bulk and small aliquots frozen
for future use. Now that you have been provided the basics on how to make a transgenic
Cannabis plant, it seems necessary to divulge into some of the candidate genes.
! $%!
6. Woody Cannabis
Nearly all plant cells have a rigid, outer protective layer called a cell wall that provides
support and protection for the cellular contents. The cell wall is not a static entity. It has
enzymes imbedded that perform a wide array of biochemical functions. The main
component of plant cell walls is cellulose, a large polysaccharide made up of glucose
monomers.
Almost anyone who has taken a basic biology class knows that a cell is the smallest unit
of life. On a microscopic scale, cells are small factories where thousands of biochemical
process are occurring each second. All plant cells also have a plasma membrane, made up
of lipid-derived molecules. Seeing how the plasma membrane helps keep a cell together
can be understood when looking at oil and vinegar salad dressing. Notice that in this
dressing there are two distinct layers, an oily (water insoluble) phase and a liquid (lipid
insoluble) phase. You have to shake the bottle of dressing to try and bring the two layers
together. But after time, the layers separate again. A cell membrane is similar to the bottle
of oil and vinegar salad dressing in that it keeps the liquid phase, which contains all of the
cell's machinery, together by making the oily outer layer called the plasma membrane.
The plasma membrane then is like an oil shell, providing a fairly constant internal
environment. Imbedded in this oily shell are proteins with various functions.
In a plant cell, in addition to the plasma membrane, part of keeping the internal parts
from bursting out from the oily shell layer (nucleus, mitochondria, chloroplast, etc.) is
provided by the most exterior layer called the cell wall. Integrity of the cell is maintained
by keeping the cell in tact by the rigid external layer of cellulose, a major component of
the cell wall. The cell wall also keeps the inner plasma membrane and its contents
protected from external environmental onslaught such as salinity changes or pressure
changes. It also protects the cell from popping due to internal pressure from water
accumulation. In fact, the cell wall was a crucial evolutionary step in the transition of
plants from their aquatic ancestors to colonize land.
There are two components to the cell wall, a primary and a secondary cell wall. The
primary wall is established first, early in the cell's life. As time progresses the cell
matures and the secondary wall is established. This wall is laid down inside of the
primary wall. The secondary cell wall is the portion that often contains higher amounts of
lignin and is at least partly responsible for what is known as wood. Laying down lignin in
the cell wall is called lignification. Both the primary and secondary wall contain cellulose
but differ in concentration of lignin and the types of proteins. Between each plant cell and
on the outside of the cell wall there is a layer of a substance called pectin, which is a
carbohydrate that essentially glues adjacent cells together. Pectin is also the substance
that is used in thickening jellies and jams.
All of this is important because an interesting discovery occurred with researchers who
wanted to understand how lignin, the main component of wood, is produced in large trees
(Kirst et al., 2003). They examined the gene sequences of Arabidopsis, which usually
doesn't produce wood.
! $&!
Using the tools of bioinformatics, which uses computers to understand sequences in
databases, they first found and identified several genes that played a role in secondary
xylem, or wood production. The researchers then started comparing the sequences of the
tree genes with Arabidopsis genes. To their surprise, they found remarkable similarities.
Although their morphological appearances were strikingly different, both shared the
genes needed for wood production. For some unknown reason, the lignin genes have
been turned off in Arabidopsis.
Since Arabidopsis, the small herbaceous mustard plant, had the genes for wood
production in its genome, other researchers have postulated that if these genes were to be
expressed, wood formation might occur. Indeed, research in this avenue has already
begun with some success (Mitsuda et al., 2007). Although Arabidopsis is usually thought
of as a herbaceous (non-woody) plant, this has been changed through the tools of
biotechnology.
Searching for the gene for wood production in Cannabis could prove to be difficult
considering that there is limited genomic information available. However, it would
indeed be possible to use the Arabidopsis study as a stepping-stone to reach the goal of
producing a woody Cannabis plant. The DNA sequence of a gene for one species is often
similar to the same gene in a different species. This is called gene homology, or as
sometimes referred to-two genes are homologous if they share similar sequences and are
found in different species. The gene for wood production is most likely hidden
somewhere in the Cannabis genome, much like it was hidden in the Arabidopsis genome.
The gene simply needs to be detected and properly expressed.
The construction of the plant cell wall and lignification depends on the activity of
enzymes responsible for synthesis of cellulose, lignin and other polymers. Most people
are familiar with plants, whether they are found in gardens, in homes, front yards, dinner
tables, or in a pipe, people are often directly interacting with plants. Interacting indirectly
with plants is inevitable, since breathing the oxygen they release is fundamental to most
life on earth. However, the great majority of people are less familiar with the plant cell.
Since Cannabis already has the machinery to produce primary and secondary cell walls,
the only necessary genetic changes would be to up-regulate lignin production in the
secondary wall. The challenge is to find and isolate the gene in Cannabis, which is
entirely possible through bioinformatics and understanding gene homology.
Transforming Cannabis with a gene for increased lignin production would be a practical
application of biotechnology. Having a woody plant would allow an outdoor gardener to
have a perennial Cannabis plant. Buying and planting new seeds to sew each year could
be eliminated. Cuttings to propagate a favorite strain would also be easier to obtain and
share among friends.
With the correct genes for both wood production and size, an extreme case of an entire
forest of Cannabis trees is possible. This would have ecological ramifications beyond
! $'!
releasing a genetically modified crop organism into the wild. For instance, imagine a
forest fire where the smoke has enough THC to get every man woman and child in an
adjacent city stoned. Firefighters rushing to the scene may find themselves unable to
focus on extinguishing the fire. Although an extreme scenario, this helps articulate the
fact that regulations of genetically modified organisms are indeed important.
Since hemp is already used as a sustainable crop in some countries, they may want to
consider growing hemp varieties with higher lignin production. These genetically
modified varieties could be useful for more durable goods than that made from traditional
hemp strains. The current hemp varieties are in fact better than trees for making paper
due in part because they have a lower lignin density. The lower lignin concentration
makes hemp an attractive plant because the higher lignin in trees requires more harsh
chemicals used in processing. In fact, it is because of the lignin that hemp is often
preferred over trees. Hemp also has a higher cellulose density than trees, making it great
for increasing product yields.
For these reasons one may argue against making a woody Cannabis plant. However, if
the countries where hemp is currently cultivated could be grown to increase lignin
production the country would surely benefit. A country with much of its land mass given
over to desert or dry area is often able to grow hemp. If these same areas could produce
lignin within their countries, they could rely less on the import of forest products. This in
turn would slow the destruction of forests in other countries. An advantage of higher
lignin content is also given to the plant. Many organisms cannot tolerate eating lignin and
therefore a transgenic hemp plant with higher lignin content may provide herbivore
resistance.
But other benefits abound for humans. A high lignin-producing hemp plant could provide
raw materials for building more durable goods than presently available from
contemporary hemp varieties. The current list of products made from hemp ranges in the
hundreds. Increasing lignin content could expand this list. Based on the current rate of
forest destruction, it may be absolutely necessary to make a transgenic hemp plant that
makes large amounts of lignin.
! $(!
7. Plant Secondary Metabolites and Terpene Production
Knowing the biochemistry that presently occurs in plants is vital to understanding plant
biotechnology. There are hundreds of biochemical pathways that lead to a plant product.
Knowing all of these pathways is unnecessary and can be time consuming (and
impossible) to learn. Therefore, one should primarily concern themselves with the
pathways that lead to important Cannabis compounds (e.g., tetrahydrocannibinol). To
begin this exploration the terpene pathway is introduced. However, it is also important to
know other plant secondary metabolites.
Previously we discussed plant primary metabolites. These consist of proteins (amino
acids), carbohydrates (sugars), fats and lipids, and DNA and RNA (nucleic acids).
Primary metabolites are crucial to plant survival. Without these four basic metabolites, a
plant could not carry out the daily requirements and processes of life.
Secondary metabolites differ from primary metabolites in that they are not always
necessary for plant survival. However, they are often advantageous or provide some
benefit to the plant. There are three major groups of plant secondary metabolites;
phenolics, alkaloids and terpenes. Phenolics are distinct in that they have a carbon ring
structure with a hydroxyl group (-OH derivative) attached. Lignin, a huge polymer of
phenolic rings, is the most common phenolic compound among plants. Other important
phenolic compounds include tannins, vanilla, nutmeg, capsaicin (the spicy hot molecule
in peppers), and anthocyanins (plant pigments).
Alkaloids represent another class of secondary metabolites. Alkaloids are bitter tasting
nitrogenous compounds. A popular alkaloid in the 1980's was *******. Other well-known
alkaloids in include atropine, caffeine, psilocybin, strychnine, quinine, and morphine.
Terpene synthases are the enzymes that synthesize terpenes, the third and final class of
secondary metabolites. Terpene enzymatic pathways have been described in detail
(Pichersky et al., 2006). Terpenes provide a wide array of functions in plants. For
example, the tail portion of the chlorophyll molecule is composed of the terpene called
phytol, which is a diterpene. Citrus smells are possible because of limonene, a
monoterpene. In total there are about 60,000 known phenolics, alkaloids, and terpenes.
Terpenes make up the largest proportion of plant secondary metabolites.
The most important terpene, at least in this book, is geranyl diphoshpate, which is needed
for tetrahydrocannibinol (THC) biosynthesis. The basic enzymatic pathways leading to
molecules of terpenes incorporate carbon molecules based on multiples of fives.
Therefore, a nomenclature system has emerged that follows this pattern.
! $)!
Similarly, a nomenclature system exists for enzymes, the proteins that act as a catalyst to
speed reaction rates. One only needs to add the suffix ‘–ase' onto a protein's function to
give it a name. For example, a transferase is an enzyme that transfers one molecule to
another and a decarboxylase is an enzyme that removes a carbon. Most of the steps
leading from one molecule to another involve an enzyme. These enzymes are desirable to
understand because over expression of anyone of these protein's genes could lead to
higher THC production in Cannabis.
The five carbon units for building terpenes consist of the phoshporylated (has a
phosphate added) starting materials isopentenyl diphosphate (IPP) and dimethylallyl
diphosphate (DMAPP). These can be joined in either “tail to tail†or “head to tailâ€
reactions. In the case of the atmosphere and its terpene constituents, the low molecular
weight terpenes have been shown to play are larger role, and hence have been more
widely studied in global climate.
Additionally, it has been observed that plants can produce terpenes (anabolism) and then
consume them by breaking them down (catabolism). Often, large terpene compounds can
be metabolically broken down and released in smaller (reduced molecular weight) forms.
The reactions of terpene biosynthesis are an important part of Cannabis biochemistry.
*
Terpene name Formula Molecular weight Isoprene units Example
Hemiterpene C5H16 76.2 0.5
2-methylbutane
(isoprene)
Monoterpene C10H16 136.2 1.0 pinene
Sesquiterpene C15H24 204.4 1.5 farnesol
Diterpene C20H32 272.5 2.0 phytol
Sesterterpene C25H40 340.6 2.5 leucosceptrine
Triterpene C30H48 408.7 3.0 squalene, THC
Tetraterpene C40H64 544.9 4.0 carotenoids
Polyterpene C!H! 100,000-1,000,000 1,500-15,000 natural rubber
! %+!
*
J,"-)*%6"=1*'(*%*(')421*'("$&1)1*molecule (C5H16) is the primary constituent of
all terpenes.
!
!
There are two pathways, which lead to production of terpenes. The mevalonate (MVA)
pathway for terpene production in higher plants occurs in the cell cytoplasm and leads to
sesquiterpenes and triterpenes. The second pathway is called the 1-deoxy-D-xylulose
(DXP or non-MVA) pathway and occurs in the plastid. This pathway can lead to
monoterpenes and diterpenes.
I2%)5*3122*(,"-')4*1%3,*51&$1)1*$%5,-%97*E1&%)92*0'$,"($,%51*'(*/(10*')*<Z!*
(9)5,1('(7
! %*!
To begin the MVA pathway, thiolase catalyzes the synthesis of acetylacetyl-CoA by
fusing two acetyl-CoA molecules. HMG-CoA synthase synthesizes acetylacetyl-CoA
with a third acetyl-CoA to produce 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). A
final reaction catalyzed by HMG-CoA reductase uses 2 NADPH to reduce HMG-CoA to
the six-carbon molecule mevalonate (MVA).
The high-energy molecule, adenosine triphosphate (ATP) is required for the next three
reactions, which ultimately lead to isopentenyl diphosphate. These reactions involve
MVA kinase, MVAP kinase, and MVAPP decarboxylase, and proceed with MVA,
mevalonic acid 5-phosphate (MVAP), mevalonic acid 5-diphosphate (MVAPP), and
isopentenyl diphosphate (IPP), respectively.
The plastidial pathway is initiated with the joining a pyruvate molecule to a
glyceraldehyde 3-phosphate molecule facilitated by the enzyme DOXP synthase. This
forms 1-deoxy-D-xylulose-5-phosphate (DOXP). This is reduced by the enzyme DOXP
reductoisomerase (DOXP-R) to form 2-C-methyl-D-erythritol 4-phosphate (MEP). A
cytidine triphosphate then incorporated to form 4-(cytidine-5-diphoshpo)-2-C-methyl-Derythritol
(CDP-ME) via the enzyme CDP-ME synthase.
An ATP is used to add a phosphate to form 4-diphosphocytidyl-2C-methyl-D-erythritol
2-phosphate (CDP-ME-2P). The enzyme that catalyzes this reaction is CDP-ME kinase.
This product is then cyclized to form 2-C-methyl-D-erythritol 2,4-cyclodiphosphate
(CDP-ME diphosphate) via CDP-ME diphosphate synthase. After removing a water
molecule, (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate (HMBPP) is formed via
HMBPP synthase. The final step removes an additional water molecule while
simultaneously reducing (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate to yield
isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).
! %"!
[/52')1*"+*5,1*395"("2'3*51&$1)1*$%5,-%9*%)0*5,1*$2%(5'0'%2*51&$1)1*$%5,-%97*
\"51*5,1*3&"((*5%2?*615-11)*1%3,*$%5,-%97*E1&%)92*0'$,"($,%51*'(*$1&,%$(*5,1*
#"(5*&121=%)5*#"213/21*5"*<Z!*6'"(9)5,1('(7
Since they are phosphorylated, the IPP and DAMPP can be used in the so-called “head to
head†or “tail to tail†combinations to build terpenes. DAMPP can also be produced from
IPP by the enzyme isopentenyl-diphosphate isomerase (IPP isomerase). Dimetheylallyl
transferase uses either IPP or DMAPP to form geranyl diphosphate or farnesyl
dihposphate via polyisoprene synthase. Geranyl diphosphate and farnesyl diphosphate are
monoterpenes and sesquiterpenes, respectively. It is geranyl diphosphate, which lends
! %#!
itself to THC synthesis. Finally, it is important to note that there can be exchange of
products between the cytosolic and plastidial pathways.
Many biochemical reactions taking place within plant cells are not carried out in such
sequential steps. Although biochemical pathways occur when precursor molecules initiate
the pathway, things can only proceed as fast as products are made. This is because
enzymes are often suspended within an intracellular matrix (the cytoplasm) or attached to
a cellular membrane, so that reactants must somehow join with the correct enzyme.
A complex interaction between enzymes and their substrate concentration is played out
where an enzyme may only be produced on demand. It follows from this that increasing
the concentration of the substrates can cause an increase the concentration of the
products. All of this has led to something called a rate-limiting step. This says that the
rate of any reaction depends on the previous reaction. When thinking about THC
production, it relies on previous steps within the THC biosynthetic process. The HMGCoA
reductase enzyme is often considered a rate-limiting step.
The enzymatic reactions taking place within the plant cell all occur very rapidly and
depend heavily on the temperature and concentration of reactants and enzymes. The
terpene pathway is one of many plant biosynthetic pathways. Therefore it is not too
surprising that the terpene pathway also overlaps with other plant pathways, including
plant hormone synthesis. For example, gibberellins and auxins are both formed starting
with a molecule of mevalonate derived from the MVA pathway.
Since THC is the most active component of marijuana smoke, the importance of its
molecular synthesis cannot be overstated. Like the terpene pathway, the THC pathway
consists of different enzymatic steps and has intermediate molecules, for example it is
synthesized via a terpene. Each of these enzymes plays a crucial role in the overall
formation of plant secondary metabolites.
Becoming familiar with both the terpene pathway and the THC pathway allows one to
understand not only key enzymes, but also the genes that encode those enzymes. This is
crucial to relating the ways in which Cannabis can be genetically transformed. For
example, in order to increase the concentration of the psychoactive component of
Cannabis, an increase in IPP or DMAPP is needed. These molecules are produced in the
terpene pathway. The gene coding for the protein that synthesizes IPP or DMAPP needs
to be over expressed in Cannabis. Choosing any gene that codes for any enzyme within
the terpene pathway might produce a similar increase, but needs to be experimentally
verified. The important component to remember from these complex pathways of THC
synthesis is that transferring any of these genes is possible with today's biotechnology
tools. Before detail on these tools and techniques are provided, a review of the THC
pathway is necessary.
! %$!
8. The THC Pathway
The terpene pathway is important to understand both because it serves as a model for the
other biosynthesis reactions, such as the THC pathway, and because the terpene geranyl
diphosphate is needed in THC biosynthesis. Similar reactions, albeit at different rates and
locations, occur within plant cells that result in production of THC. The chemical
structure of THC was first determined in the 1930's (Pertwee, 2006). Knowing the
complete pathway to its production is considered an important piece of Cannabis
biotechnology.
*
*
!
J,"-)*,1&1*'(*5,1*#"213/2%&*(5&/35/&1*"+*<Z!8*%)0*<Z!*-'5,*%&&"-(*$"')5')4*
5"*5,1*=%&'%5'")*')*5,1*('01*4&"/$7*<Z!8*'(*5,1*3"#$")1)5*')*!"##"$%&*$2%)5(*
%)0*'5*'(*)"5*/)5'2*'5*'(*6/&)10*5,%5*<Z!*'(*+"&#107*
!
Interestingly, it is not until THCA is burned that it becomes chemically modified into a
more psychoactive form, which is THC (Hazekamp et al., 2005). The burning causes a
decarboxylation reaction, or a loss of a carbon group that is on the THCA molecule,
thereby converting it to the more psychoactive THC molecule.
However, the THCA component of Cannabis is the precursor of THC, so its formation
and accumulation within the plant influences the amount of THC when the plant is
smoked. Again, part of the THCA molecule is derived from the terpene geranyl
! %%!
diphosphate. Synthesis of THCA begins when a molecule of geranyl diphosphate (a
monoterpene) is joined to a phenolic ring (a circular molecule with six-carbons). This is
why THC is sometimes referred to as a terpenophenolic. Because it has a few extra
molecular attachments, the phenolic ring is called olivetolic acid and it is through the
enzyme geranylpyrophosphatelivetolate geranyltransferase that forms cannabigerolic
acid, or CBGA. The final product after CBGA formation is THCA by way of
tetrahydrocannabinolic acid (TCHA) synthase. Subsequently, high levels TCHA are
found in Cannabis trichome cavity (Sirikantaramas et al., 2005).
*
8*2""?*')('01*5,1*!"##"$%&*3122D*(,"-')4*41&%)92*0'$,"($,%51*%)0*"2'=15"2'3*
%3'0*3"#6')')4*5"*9'120*<Z!87
The pathway leading to olivetolic acid is most likely synthesized from three molecules of
hexanoyl-CoA. However, work remains to be done to in order to understand the synthesis
of THCA in its fullest extent. Details on each enzymatic reaction, their substrates and
their products have been recently provided (Taura et al., 2007).
With all this biochemistry comes the curiosity of why Cannabis has evolved to produce
THC-like molecules. It has been hypothesized that the molecules can act as a sunscreen
for the plant (Lydon et al., 1987). In fact, research has shown that THC can absorb UV
light, thus the plants are protected from harmful radiation. Additionally, THC precursors
have believed to have antimicrobial activities, therefore these cannabinoids may also play
a role in plant defense.
Since the part of the biochemical pathway of THC has been elucidated, picking some of
the genes from the pathway for transgenic manipulation is possible. For example, if
! %&!
THCA synthase is attached to the CAMV35S promoter it will be highly over expressed.
This would produce transgenic lines of Cannabis that are loaded with THCA.
Putting these genes into other plants may serve useful to people in countries where
Cannabis cultivation is illegal. One species of plant that might be desirable to genetically
modify with THC genes is the weed species, Amaranthus retroflexus. This plant is in the
family Amaranthaceae, also known as the pigweed family. The common name for this
plant is redroot pigweed and is consumed as a food in some parts of the world (Kong et
al., 2009).
One reason for its candidacy for genetic modification stems from the fact that it is a
weed; it grows along railroad tracks, in ditches, and even between cracks in the middle of
parking lots. Therefore, very little labor would be required from the cultivator to maintain
healthy pigweed plants.
A second reason for its candidacy is that the flowers of pigweed are large and bulky. This
would provide the obvious advantage of producing large quantities of finished product.
Additionally, it needs little water, grows rapidly, produces lots of seed, and tolerates poor
soil and harsh growing conditions. In many respects it behaves like Cannabis, but is
legal. Growing a few plants of pigweed would not send the police to your house. For
instance, growing pigweed next to your tomato plants in your garden would not seem that
strange. Neighbors would not give the situation a second thought.
,
! %'!
'4"("#-.3&,(2-(*5/263&D*%*3%)0'0%51*+"&*41)15'3*#"0'+'3%5'")*-'5,*5,1*<Z!8*
(9)5,%(1*41)17*<,1*5"$*21+5*3"&)1&*(,"-(*%)*/$K32"(1*='1-*"+*5,1*2%&41*+2"-1&*
32/(51&(*"+*5,'(*$2%)57
! %(!
The prospect of growing a legal THC-containing plant might also seem alluring to
medical marijuana users. Within the US, medical marijuana is currently legal in only a
handful of states. While other countries have legalized or promoted the use of medical
Cannabis, the US Food and Drug Administration (FDA) has historically declared
marijuana to have only limited medical potential. This is contrary to continuing scientific
findings and the fact remains many patients currently use medicinal marijuana with or
without a doctor's recommendation.
The inflorescence (flower) of pigweed can be much larger and bulkier than marijuana,
which would allow for production of large amounts of medication for medical marijuana
patients. The biotechnology for producing transformed, THC-containing plants might be
an effective way to bypass legal issues and still allow sufferers of chronic illnesses to
self-medicate. Since Amaranthus is known to harbor terpenoid biosynthetic pathways,
inserting the THCA synthase gene should result in THC production.
Transforming a plant with one gene is relatively straightforward. Inserting multiple
genes, called gene stacking, has proven to be more difficult. In the past researchers had to
do laborious transformations starting with one gene, then grow the plant into an adult,
and breed it for multiple generations. Only then could they use this stem tissue for
creating calluses and insert a second gene. Success was far and few between. Fortunately,
many new vector systems, mainly in the form of plasmids, have shown to be more
versatile in their capacity to deliver multiple genes simultaneously (Dafny-Yelin and
Tzfira, 2007). The emergence of artificial plant chromosomes has allowed putting several
genes together and inserting them into a vector. With time, the complete THC pathway
will undoubtedly be inserted into other plant species.
! %)!
9. Smoking Roses and Other Proposals
There are limitless ways in which Cannabis and biotechnology will influence one
another. Having a basic knowledge of science and biology is imperative, but having an
imagination might prove equally as important. However, thinking of concepts and
applying logical ideas to them begins with a solid science education. This allows one to
gather reasonable arguments as to possibilities of Cannabis transformation that may arise
in the near future.
Work has already begun with yeast cells (Taura et al., 2007). These small fungi were
genetically modified to express the THCA synthase gene. Workers from the same lab
were also responsible for transforming tobacco, albeit under special conditions
(Sirikantaramas et al., 2004). For example, the THCA synthase enzyme had to be
provided with the THCA precursor molecule (cannabigerolic acid). The tobacco cells
were also grown in vitro. Nevertheless, the gene for THCA synthesis has been shown to
have the ability to successfully transfer and expressed in organisms other than Cannabis.
Some of the fastest advances in improving Cannabis and other plants have been through
application of chemicals or hormones. For example, inducing chromosomal duplications
in plants has been occurring since the discovery of colchicine. This chemical interferes
with the proteins that pull chromosomes apart during cell division. Applying colchicine
has been shown to cause complete genome duplications. Sometimes this leads to
doubling of all gene products and not just the genes. It follows, then, that a Cannabis
plant treated with colchicine might result in production of twice as much THC than an
untreated plant.
Although colchicine is commercially available, performing more drastic genetic
experiments are not so easily available. These require special aseptic conditions and
access to the necessary technology. Once these obstacles are overcome, transforming
Cannabis with any gene is simply a game of experimentation.
It is indeed possible to control genes and cause them to be upregulated in order to
increase their gene product. To do this, the known gene has to be attached, or ligated, to a
special region that communicates this to the Cannabis cell. This region is called a
promoter region, since it promotes the expression of that gene. The promoter region sits
just ahead of the gene along the chromosome.
Some promoter regions have been found to have such strong expression activity, that they
are routinely used in plant biotechnology. One such promoter is called the CaMV 35S
promoter (Venter, 2007). This promoter was first found in a virus, then carefully
removed, and finally ligated to a plant gene. When researchers did this they found that
whatever gene was attached resulted in a constant expression of that gene. The CaMV
35S promoter has since proven to be a useful promoter to make transgenic plants that
express large amounts of a foreign gene.
Since there is overlap of the THC and terpene biosynthetic pathways, adding an
! &+!
additional two or three terpene genes to Cannabis will likely result in that terpene
product. For example, many fruit scents and flavors are terpenes. Most anyone is familiar
with the citrus smell of an orange, grapefruit or lemon. This smell is the result of a
terpene known as limonene.
The biosynthesis of limonene is so well understood that there are multiple transgenic
plants that have been made expressing limonene. Putting the limonene gene into
Cannabis would give the buds a citrus-like smell. While some may find this aesthetically
appealing, others might simply enjoy something different. From a practical standpoint,
the paranoia of indoor growers might decrease upon learning that the smell their
neighbors are complaining about is lemons rather than from marijuana cultivation.
Since the precursor molecules needed early in the pathway of THC are known, increasing
these initial pathway substrates might result in more THC production. IPP and DMAPP
are the starting materials for terpenes. Upregulating the genes (isopentenyl diphosphate
synthase and dimethylallyl diphosphate synthase) would provide this possibility. These
gene sequences are known in other plants, therefore a model for isolation and
amplification of the Cannabis IPP and DMAPP synthase genes is available.
Another interesting experiment focuses around Cannabis flowers. Many roses are
currently sold as so called, double roses. This is because they have two whorls of petals,
not just one, as in typical roses. This was brought about not by genetic modification, but
through discovery of a mutant double flowered rose. The mutant was subsequently bred
with other roses to distribute the mutation through the offspring. Selection for double
roses and crossing between double roses produced only double roses, so much in fact,
that there are complete genetic lines of double flowered roses.
One of the most prominent desires from Cannabis growers is to increase yield. Many
cultivators would rather grow one plant that yields 2 kilos than to grow five or six plants
that produced this same amount. Luckily for Cannabis growers, a single gene controls
flower size, at least in some plant species. Upregulating this gene then, would be of huge
importance to the Cannabis community.
A different approach to making larger flowers in Cannabis would be to express the gene
for petals. The transcription factors of the ABC flowering model could be exploited to
facilitate this goal. Although Cannabis lacks petals, manipulation of the ABC
transcription factors could overcome this barrier.
Conversely, ignoring the petals and focusing on the sepals could produce a similar
outcome. Luckily enough, the A transcription factor controls both sepal and petal
production. Therefore, up-regulating the A transcription factor would likely result in buds
with enlarged petals and sepals. Ultimately, different experiments would be required to
find the best combination of which genes to up-regulate. In addition to larger buds,
producing many more buds seems just as important.
! &*!
Perhaps the goal should not be to make larger flowers or have more of them. Considering
how plants make their food might equally result in an increase in growth of its buds or at
least the time needed. For example, if the genes for photosynthesis are upregulated,
conferring hyper-photosynthetic ability, may shorten the time needed to grow Cannabis
in the vegetative stage. Cannabis producers could have the vegetative state of Cannabis
finish in two months instead of four months.
The possibility also exists that one can manipulate the genetic expression of trichomes.
The gene for trichome production has been found and described in detail. With trial and
error, a Cannabis plant with twice as many trichomes might result in twice as much THC.
Alternatively, the entire Cannabis plant can be discarded. Inserting THC-synthesizing
genes into any plant that can be cultured in vitro is a possibility. Roses with THCproducing
flowers may soon be available to everyday gardeners. The benefits would be
obvious. Since roses are perennials, their flowers can be harvested every year, sometimes
more than one time a year. Roses also have the unique characteristic of being able to
bloom multiple times in a season, which would provide a continuous supply of TCHcontaining
flowers.
Before Cannabis consumers celebrate these transgenic advances with too much
excitement, there remains a caveat. If marijuana seed companies choose, they might use a
method similar to that which the agricultural biotech seed companies have chosen. For
example, in some transgenic food crops a suicide gene is inserted into the seed so the
person harvesting the crop will be unable to use seed from that crop for planting the
following year. The suicide gene essentially renders the seed infertile. This was the
method that the large agricultural giant Monsanto used in their “terminator†technology.
If a seed company has invested many months or years developing a plant, they may deem
it necessary to protect its secrets and stay in business. For now at least, marijuana seed
companies appear to be following a different philosophy than that of today's corporate
agricultural giants.
! &"!
10. Cannabis DNA Sequencing
All life uses deoxyribonucleic acid (DNA) to transmit information to its offspring. In
eukaryotes (e.g., Cannabis and humans) DNA is contained in a nucleus, while
prokaryotes (e.g., Agrobacterium and other bacteria) lack a nucleus. Bacterial DNA floats
within a localized region, often called the nuclear region. The DNA represents the
organism's genetic material. The scale of view transforms along a finer gradient from
chromosomes (or plasmids) to DNA to gene and finally to nucleotide bases.
Understanding how the order of nucleotide bases (adenine, thymine, guanine and
cytosine) contributes to an organism is fundamental to understanding an organism.
DNA sequencing began with scientists counting one base at a time. The bases were
translated as patterns or marks on paper and identifying a base was done manually. The
process was long and difficult, partly because it required the use of small amounts of
radioactive materials.
The development of automated sequencing resulted in a rapid increase in the number of
base pairs that could be read. Additionally, the accuracy and reliability increased.
However, the DNA had to be moved through large slabs of a gel. The process was less
labor intensive than counting manually and by hand as they did in the beginning of
sequencing projects but still consisted of hours of careful work.
Recently there has been rapid progress in DNA sequencing technologies. This has
claimed the name, next generation sequencing and represents most of the tools currently
used in sequencing labs. However, the technology continues to evolve, becoming
cheaper, faster, less labor intensive and more reliable. Researchers are now trying to get
the enzyme that polymerizes (extends or makes more of) DNA to do sequencing for
them. In this way, sequencing a DNA strand can be accomplished in real time through the
work of an enzyme. Because enzymes are so fast in their reactions, using DNA
polymerase would throttle sequencing speeds to an unprecedented rate.
Currently, there is a mad race to learn the sequence of as many organisms as possible.
Although this started with sequencing a bacterial virus, the trend quickly spread to
include the human and model organisms (e.g., Arabidopsis, mouse, and yeast). Knowing
an organism's genetic sequence provides a blueprint for manipulating and experimenting
in order to discover biological secrets.
Since there is so much DNA sequencing data being discovered, there has evolved large
databases to in which to deposit this digital data. The European Molecular Biology
Laboratory (EMBL) is centralized in Heidelberg, Germany but also has other extensions
across Europe. The portion of EMBL involved in DNA sequencing is often referred to as
EMBL Nucleotide Sequence Database or, more succinctly, EMBL-Bank. It is important
to understand that there is a physical laboratory and then there is also a digital storage
component. This is the same situation for another large laboratory in Japan called the
DNA Database of Japan (DDBJ).
! &#!
The final database is called GenBank (in Bethesda, Maryland), which is part of the
National Center for Biotechnology Information (NCBI). EMBL-Bank, DDBJ and
GenBank are the three large constituents that comprise an international consortium of
bioinformatics data (essentially digital data). Each database is linked to one another and
they exchange information daily. For instance, although the scientists who sequenced
THCA synthase were from Japan and deposited their gene sequence data in DDBJ,
people in Europe and North America also have access to this sequence. In fact, anyone
with an Internet connection has free access to any sequence data deposited in any of these
three databases.
*
<,1*@\8*(1L/1)31*"+*<Z!8*(9)5,%(1D*5,1*$&"51')*&1($")('621*+"&*<Z!8*
(9)5,1('(7*<,1*(1L/1)31*"+*)/321"5'01(*'(*5&%)(2%510*')5"*%)*%#')"*%3'0*
(1L/1)31D*-,'3,*3")(5'5/51(*5,1*<Z!8*1)A9#17
! &$!
J3&11)(,"5* "+* 5,1* \!FW* -16* ('517* J1%&3,1(* 3%)* 61* $1&+"&#10* #%)9* 0'++1&1)5*
-%9(*')32/0')4*?19*-"&0(D*)/321'3*%3'0*(1L/1)31(D*"&*$&"51')(*(1L/1)31(7
There are thousands of different proteins, all encoded by different sequences of
nucleotides (e.g., adenine, guanine, cytosine, and thymine). Imagine finding a DNA
sequence that coded for an enzyme that gobbled up hazardous waste, rapidly removed
carbon from the atmosphere and could combat global climate change, synthesized a lifesaving
drug, or that could break down garbage in city dumps or pollutants in streams.
These examples highlight just a few of the reasons why knowing as many sequences as
possible is beneficial. Knowing the sequence of an organism allows researchers and
bioinformaticists to tease out these important protein biomachines. There are many
methods of DNA sequencing, with so-called next generation sequence methods gaining
popularity because of its affordability and increase in data output.
Before a complete Cannabis genome sequence is provided to the public, a more
affordable and abbreviated sequence may arrive first. This technique is called a cDNA
library, much like a library where people borrow books. When a plant makes a protein it
! &%!
must obey the central dogma of biology and the central dogma is fundamental to any
biology student. The central dogma is logical in its flow and can be easily understood
upon closer inspection.
The central dogma of biology states that a gene is the sequence of nucleotide bases that
resides on a chromosome within the nucleus. A gene has the ability to be turned on or off.
When a gene is turned on, it produces a transcript called messenger RNA, or mRNA.
This mRNA is moved from the nucleus to the cell cytoplasm where it is translated by
ribosomes. Ribosomes clasp the mRNA, which then allow binding of amino acidcarrying
molecules called transfer RNA, or tRNA. This is an extremely macroscopic
view, as the actual events are based on subatomic interactions that happen in a fraction of
a second.
The amino acids that arrive on the tRNA are attached in an order that compliments the
sequence of the mRNA strand. Each amino acid brought to the mRNA has a unique side
chain that interacts with its environment. The interaction with all of these different side
chains (one for each of the 20 amino acids) elicits different properties that make it unique
to the function of the protein to which they are incorporated. Since every DNA sequence
is slightly different, organisms can produce a huge variety of amino acid sequences that
fold into many different enzymes.
Regardless, the entire central dogma starts with a gene, which is then changed into
mRNA, and ends with a gene product (a protein). One important tool used in sequencing
today is the cDNA library. This is the representation of all or most of the expressed genes
in a tissue at any given time. To make a cDNA library the mRNA is first isolated from a
tissue or organ. Using enzymes within a small reaction tube, this mRNA strand is reverse
transcribed back into DNA. The molecule remaining is complimentary DNA, or cDNA.
Thus, a collection of cDNA sequences is called a cDNA library. These can be sequenced
and compared to known sequences in the large public databases such as GenBank.
! &&!
*
8)*"=1&29*('#$2'+'10*01$'35'")*"+*,"-*5"*(1L/1)31*1C$&1((10*41)1(*+&"#*
!"##"$%&7*3@\8*2'6&%&9*3")(5&/35'")*'(*&"/5')129*0")1*+"&*#%)9*"&4%)'(#(*%)0*
"+51)*+"/)0*')*0%5%6%(1(*%(*1C$&1((10*(1L/1)31*5%4(*:GJ<(;7
Obviously, there will be many different genes being produced in any cell at any time. For
instance, flowers will have different cDNA sequences then sequences from a root cell.
Different biotechnology companies provide complete cDNA construction kits, and all
cost relatively modest amounts. However, one can also choose to send isolated Cannabis
RNA to a company that will construct and sequence a cDNA library for an extra charge.
However, some Cannabis cDNA sequences do exist. As mentioned, the public database
GenBank is a repository full of digital information and can be freely searched. Currently,
the majority of sequences available in this database are from a hemp plant, what most
Cannabis cultivators would not find very interesting. However, it can be used to study
other aspects of Cannabis. There are also a handful of Cannabis sequences from other
researchers as well. Since this information is publically available, anyone with an Internet
connection has access. With such huge amounts of genetic data and so few researchers
mining the information, potential discoveries are waiting to be found this very moment.
! &'!
11. Molecular Tools
There are a plethora of molecular tools being used in molecular biology today. Covering
them all would be far beyond the scope of this book. However a few important and
common methods are covered. Reading this chapter will certainly help in understanding
greater detail on how transgenic plants are made.
Perhaps the tool that any individual wanting to learn plant biotechnology must become
familiar with is the polymerase chain reaction (PCR) This process was developed in the
1970's and has been a crucial advancement to the development in all areas of molecular
biology and biotechnology. Starting with a DNA sample, any sequence from that sample
can be amplified in sufficient quantities to perform further experiments. The entire
process takes only a few hours.
It is important to make many copies of a DNA segment (a gene) because the gene of
interest must be amplified in large numbers before any other experiment can proceed.
Since there are many different genes along a DNA strand, the first step is identifying at
least a portion of the gene sequence that one is interested in isolating.
For example, isolating the THCA synthase gene requires starting with a sample of DNA
that contains the specific DNA sequence that codes for the THCA synthase protein. This
particular sequence on the DNA would be found in virtually any Cannabis plant. The
total genomic DNA (DNA isolated from the nucleus) is placed in a small test tube. In
addition, single stranded DNA fragments are added called primers that are 20 bases long.
The primers are added in very high concentrations because they get used up each time the
gene is amplified. Because the primers have the exact opposite sequence of the gene of
interest they bind and are able to anneal (or bind to) to the DNA molecule. Ideally, the
primers flank the sides of the gene.
Primer 1- tacttaacgagtcgtaaaag
Primer 2- cacttttggtttcgactaggc
In the test tube there is also an enzyme called DNA polymerase. This was discussed
previously when discussing how plasmids replicate at the ori region. As is the case with
both making more plasmid or more of a gene, DNA polymerase can only bind to double
stranded DNA. Therefore, when the primers bind to their complementary sites along the
DNA sample, DNA polymerase is then allowed to attach and begin to polymerize a new
fragment of DNA. Momentarily, however, in order to allow the DNA polymerase to
make more of the gene of interest, such as the THCA synthase gene, the double helix of
DNA must first become a single helix to allow primers to bind.
The details of this mechanism rely on manipulation of temperatures. To separate out the
DNA double helix in the sample, the sample tube is heated to 94°C/201°F. The high
! &(!
temperature melts the two genomic DNA strands apart from one another. A sudden drop
in temperature to ~55°C/131°F allows the smaller primers to find and anneal to the single
stranded genomic DNA. Once the primers are in place, the temperature rises to
72°C/162°F and the DNA polymerase is activated and polymerizes a new strand of DNA,
in our example, the sequence for THCA synthase. Since the primer is at a much higher
concentration than genomic DNA, repeating the series of temperature cycles allows DNA
polymerase to amplify a specific fragment of genomic DNA.
Often the PCR is carried out in a small machine that is automated to change temperatures
very quickly. The changes in temperature that allow for separating the double helix
strands, allowing primers to bind and activating DNA polymerase, can continue for many
cycles. The more cycles of this pattern of temperatures will allow for more gene product
to be amplified. Even if a homologous sequence is known, primers can be made based on
that sequence and a researcher can at least try to amplify a desired gene.
This amplified gene product, or PCR product, can then be slightly modified and
successfully transferred and ligated into a suitable vector such as a plasmid. This is
because the PCR product is a perfect double stranded piece of DNA with a single base
overhang on each end. This makes the ends “stickyâ€, which means they are able to fit
attach to another, complimentary end of DNA. For this reason, some plasmids are
designed to have a single base overhang that compliments the PCR product. Putting the
plasmid into a small tube with the PCR product provides the chance for these two pieces
of DNA to stick together. The enzyme DNA ligase seals the bond between the overhangs
that have hopefully found one another.
The ligated plasmid can then be successfully put into Agrobacterium. This can be done
via electroporation or heat shock. Once Agrobacterium takes up the plasmid, successful
genetic transformation of plant calluses can occur.
Often, when the PCR method is finished, the DNA polymerase, ions, and bits of small
nucleotides (like excess primers) must be removed before the PCR product can be used.
This requires using a small block of gel that rests within a box. The PCR reaction is put
into a small hole, or well, of the gel. The box is able to harbor a current of electricity so
the DNA molecules separate. Since DNA contains lots of negatively charged phosphates,
it migrates toward the positively charged end of the box. This procedure is aptly called
gel electrophoresis.
! &)!
*
8*412*12135&"$,"&1('(*%$$%&%5/(*/(10*+"&*(1$%&%5')4*@\8*6%)0(*"+*=%&'"/(*
('A1(7*@\8*#"=1(*5"-%&0(*5,1*$"('5'=1*:&10;*1)0*%)0*%-%9*+&"#*5,1*)14%5'=1*
:62%3?;*1)07
The image taken from a gel electrophoresis is often shown on popular TV programs.
Usually this follows a crime scene investigation. There are apparent bands, which mean
nothing to the actors, and the viewers are supposed to infer some meaning. Television
grossly exaggerates reality and fails to explain anything with any clarity. In the real
world, understanding what the bands mean and how they became apparent is in fact
necessary.
Importantly, the rate that the PCR product moves through the gel depends on its length. A
longer piece of DNA will not be able to travel very fast through the gel, and so remains
closer to the end of the box where it was inserted into the gel well. Smaller fragments of
DNA travel faster through the gel and so a band farther down from the well implies the
fragment is smaller in length. The size of each band infers something about the size of the
DNA molecule, which represents the actual band. To make the bands become visible a
special dye is added to the gel and a light is applied, similar to eliciting the green
fluorescence from GFP. The difference is that the bands glow and a picture can be taken
and later analyzed.
If desirable, the band of DNA can be cut from the gel using a sharp blade. The small
piece of gel is placed in a tube and a series of clean up reactions is performed to remove
! '+!
the gel but leave the DNA behind. This DNA can be used in further biotechnological
applications or assays.
The US Drug Enforcement Agency (DEA) employs scientists who use specific primers
that bind to particular regions of Cannabis DNA. They often use many different
sequences of primers, which yields many different banding patterns. Since the Cannabis
has genetic varieties across the nation and globe, not all primers will bind to the same
regions of Cannabis DNA and, thus, patterns of bands will naturally be observed. This is
what is referred to as the genetic fingerprint. The genetic fingerprint can be helpful in
tracking where marijuana supplies are flowing from and, with enough samples, even
specific routes of transport can be elucidated.
Determining if a gene has been successfully transferred and is being expressed in a
Cannabis plant requires extraction of the RNA. The gene in the plant should be present
and if expressed, it will be in the form of mRNA. If the expression of the gene is
detected, then one can rightfully confirm successful transformation. As most molecular
biologists know, working with RNA can often be tricky due to ubiquitous degradating
enzymes. However, techniques can be employed to ensure proper experimental control.
In any case, if one is careful enough, a procedure called a northern blot can be carried out
for confirming that a transformation experiment was successful. Once the Cannabis
mRNA is extracted it can be separated on a gel and then transferred to a nylon
membrane. Similarly, it can be directly spotted onto a nylon membrane. A single stranded
DNA probe that has the capability of fluorescence or radiating a mark onto a special film
is applied to the nylon membrane. If the single stranded DNA probe finds an opposite
sequence of mRNA on the nylon membrane, it will successfully bind. The nylon
membrane is washed in special reagents. When placed under light a signal of
fluorescence will be detected if the mRNA was originally present.
Methods and machines also exist to quantify the amount of mRNA at any given time. In a
process called quantitative real time PCR (QRT-PCR), an RNA sample is amplified,
similar to regular PCR. However, the PCR machine used is connected to a detector that
can monitor the accumulation of the PCR product. This results in the ability to work in
reverse and determine the original quantity or RNA that was present. Again, if the RNA
is not present, the primers will not be able to bind and amplify anything, so nothing will
be detected by the QRT-PCR machine.
Another method similar to the northern blot is called a southern blot. It uses similar
principles but is used with DNA instead of RNA. Western blots are also used in
molecular biology. These use neither RNA nor DNA and instead are used in studying and
detecting proteins.
Many techniques also exist to take a gene back out of a plasmid. This might be desirable
if a person was to put their plasmid into a bacterial cell, then grow the bacterial cell in
bulk. After spinning the bacteria and removing the media, a basic plasmid extraction can
be performed. This leaves the researcher with a pellet of plasmid DNA that contains a
! '*!
gene of interest. The sites flanking the insert is known, so unique enzymes that will snip
the insert out of the plasmid can be used. The resulting reaction can be separated on a gel
as described earlier. The bands can be cut and cleaned for future use.
Some techniques rely on previously determined sequence data. If a cDNA library is made
from Cannabis, then short sequences of ~50bp from these sequences can be attached to a
glass slide in a matrix-like array, properly called a microarray. A person can then isolate
mRNA from any Cannabis plant and place that mRNA sample onto the microarray.
Often, the plant sample obtained has recently been under salt stress, drought stress, or any
biotic or abiotic influence. The mRNA is then added onto the microarray. The glass slide
containing the ~50bp fragments may contain hybridized mRNA sequences and this can
be confirmed by using a microarray scanner. Fluorescence is observed where there are
hybridization points. This method can provide an entire genomic expression profile for a
plant. From this, metabolic pathways, developmental regulation, and environmental
response genes can be studied for expression patterns and levels.
One of the newest fields of molecular biology is using RNA molecules to bind to and
inhibit mRNA sequences from making their way to the ribosome. For this reason the
technique has been dubbed RNA interference (RNAi). Research has since shown that the
joining of a 20-25 base pair long RNA molecule to a complimentary mRNA strand,
initiates a degradation pathway, destroying the mRNA. In other words, the mRNA leaves
the transcribed gene unable to make its way to the ribosome to be translated. Because the
mRNA molecule is the blueprint for manufacturing a protein, the cell can't function
properly and dies.
There are potentially detrimental effects RNAi could have on Cannabis growers. For
example, RNAi could be used as an herbicide (targeting Cannabis). This might consist of
applying plant vectors or naturally occurring plant viruses that have an RNAi sequence.
The vector would then need to insert the RNAi into the plant cell. Genetically modified
plant viruses could one day carry out this process.
RNAicide, a term coined from RNAi and herbicide, might someday replace conventional
herbicides. In the case of eradication of Cannabis fields, RNAicide would need to be
directed at a sequence-specific (and species-specific) mRNA target, thereby initiating the
gene-silencing pathway. This view represents an extreme case of plant biotechnology,
and is not yet being tested.
However, rather than targeting marijuana with a pesticide, just the opposite is possible.
The gene for pesticide resistance can be inserted into marijuana. This has been done for
multiple crop species including soybean and corn. The gene for pesticide resistance also
has been inserted into cotton. In fact, of all the transgenic crops produced in the world,
pesticide resistance is the most common trait that has been exploited. At first glance it
may seem odd that humans have inserted a gene for pesticide resistance into the major
crop species. Further inspection reveals the logic behind this situation.
! '"!
Throughout history pesticides have been used to fight unwanted weed and insect species
from encroaching on cultivated food. Pesticides include both insecticides that target
insects and herbicides that target herbaceous plants (weeds). Chemical companies
profited from pesticides by making billions of dollars, farmers could better control their
land, governments obtained larger profits and less land was needed to obtain greater
yield. It was not until Monsanto, perhaps now the worlds largest agribusiness, inserted a
gene for herbicide resistance into crops that ultimately led to such unforeseeable profits.
The most common gene used in pesticide resistant crops is resistance to glyphosate.
Glyphosate is more commonly known as Roundup. What glyphosate does is it inhibits a
plant's ability to manufacture amino acids that have an aromatic ring (a six carbon circle)
attached. By inhibiting this metabolic pathway, which is called the shikimic acid
pathway, a plant cannot manufacture functional proteins and dies. Subsequently, the
enzyme is called 3-enolpyruvylshikimate-5-phosphate synthase, or EPSPS for short.
Transgenic crops with glyphosate resistance have a variant form of EPSPS and so are not
affected by glyphosate. The glyphosate herbicide is non-specific that is it can inhibit any
green plant from making aromatic amino acids.
If a crop species such as corn is not inhibited by glyphosate a farmer is able to apply this
herbicide across an entire field. Since the entire crop of corn has this gene for glyphosate
resistance only the weeds surrounding the field will be killed. This leaves more sun,
water and soil for the crop species and allows for easier production of the crop.
This process has large implications for marijuana growers. First, if cultivators are
growing their crop on many acres, glyphosate-resistant Cannabis could be sprayed with
glyphosate and reduce competition from surrounding plants. This would ultimately yield
larger quantities and therefore may require smaller space to produce more Cannabis.
Secondly, the US government carries out glyphosate spraying on Cannabis crops. If
producers were growing genetically modified Cannabis, application of glyphosate would
have no effect on the plants. In fact, the US government would be doing a favor to
growers by limiting the surrounding vegetation. One may wonder when the successful
drug lords will begin investing in Cannabis biotechnology.
In summary, the mechanism for glyphosate resistance has been described in greater
detail. The molecular function of the gene for resistance, EPSPS, has also been described
in detail. Since this gene can be inserted into plants, glyphosate resistance is potentially
less than a year from being reality. Other herbicides sprayed on Cannabis crops also have
known resistance genes. Therefore, it is up to the researchers working on the betterment
of Cannabis to transform these genes, in addition to glyphosate resistance, in order to
preserve the vast fields of Cannabis product.
*
*
*
*
*
! '#!
NO7*Marijuana Laws, Regulations, and Education
!
Before beginning any Cannabis research it is important to know the laws and regulations.
Research laws vary among countries. Some states within the US have some of the most
stringent laws on simple possession of marijuana while other states are more progressive.
For example, California legalized medical marijuana in the mid 1990's. Recently there
has been legislation initiated within California and Massachusetts to legalize marijuana to
increase state revenues, possibly providing more than a billion dollar in revenue.
The ease people can grow marijuana is obvious. After all, it evolved as a weed and shows
its resilience by taking up residence in waste sites and along roadsides. Among the plant
kingdom, its large equatorial range is difficult to surpass. It seems hopeful that research is
becoming more progressive and research on Cannabis is becoming less restricted.
Japan has produced some of the most recent research on elucidating the THC pathway
and potentials for THC in biotechnology (Sirikantaramas et al., 2007). However, science
is an international phenomenon and listing all who have contributed to Cannabis research
is far beyond the scope of this book.
In other countries, especially in the United States, governments limit or prohibit
Cannabis research. At least in the United States, this may be due to the fact that the
politicians are making a portion of their salaries from alcohol sales tax. Many people
think that marijuana, if legalized for recreational purposes, might be incredibly difficult
to regulate by a government.
Limitations have also been placed on medical marijuana clubs and repositories, which
were routinely raided by federal officials under the Bush Administration. Since President
Barack Obama has taken office, his administration, specifically the Attorney General Eric
Holder, has publically announced they will not interfere with state medical marijuana
laws (i.e., no more federal raids). The Obama Administration has seemed so progressive
on marijuana laws that the slogan, “Yes we cannabis†has emerged. (His popularized
campaign slogan was “Yes we canâ€.)
Much of the debate around marijuana seems to have emerged partly from the U.S. antimarijuana
campaign. This misinformation has greatly distorted the science behind
marijuana. However, informative and objective literature has been circulating among
scientific circles on the potentials of Cannabis and its influence on the brain.
What is currently known about the physiological influences is that marijuana's
psychoactivity can be attributed to cannabinoids, small molecules with a distinct
molecular conformation that bind to distinct mammalian cell receptors. The highest
concentrations of these cannabinoids are found in Cannabis flowers. Humans too, make
cannabinoid-like compounds internally, called endocannabinoids. We have subsequently
evolved cell receptors (proteins on our cells' plasma membranes) for these internally
produced (endogenous) molecules to bind and cause a cascade of biochemical reactions.
This reaction ultimately provides the euphoric feeling, or high, after smoking. However,
! '$!
the binding of THC to our cells' receptors is actually due to cross-reactivity. In other
words, it's due to sheer chance that THC binds to cell receptors that originally evolved to
allow endogenous molecules to bind.
While the cannabinoid-like compounds in our bodies (called endocannabinoids) elicit the
same euphoric response as THC, they have a noticeably different molecular structure.
Still, they have enough similarity in their overall molecular structures that THC crossreacts
and can bind the receptors to elicit a euphoric effect. The details of the physiology
and underlying mechanisms of reactivity have recently been outlined in explicit detail
(Berghuis, 2007).
Previous studies, which have warned of the negative effects of smoking marijuana, were
exaggerated with faulty claims (Ponto, 2006). On the contrary, it has been demonstrated
that mice given cannabinoids stimulates neuronal activity within certain regions of their
brains. Indeed, endocannabinoids have been shown to play a large role in facilitating
neuronal growth and development (Harkany et al., 2008). I have often wondered if highranking
officials suppress marijuana because of its potential to produce new ideas and
make people feel more spiritually empowered. If people were indeed able to think for
themselves, they would not be so heavily dependent on a government's direction on how
to live their lives through societal servitude.
Scientifically studying how Cannabis interacts with our nervous system could be helpful
in many ways to the public. The diminishing use of alcohol would serve a larger benefit
to all of society. This logic has repeatedly been presented from many different groups
trying to both prohibit alcohol and to legalize marijuana. The fact remains that drunk
drivers, child and spousal abuse, binge drinking, violence and harsh crimes, cancers and
liver failure, and public stupidity almost always involve alcohol consumption. In addition
to the nearly infinite list of dangers that alcohol offers, it is a biological toxin and is used
routinely to kill microbes on surfaces, in wounds, etc. With so many negative effects
stemming from alcohol, one should logically expect to see politicians embracing safer
alternatives to alcohol, such as marijuana.
Public education has largely remained a grass-roots effort to discuss the benefits and
science of marijuana, although Oxford University Press has recently published the second
edition of, The Science of Marijuana. Popular culture (e.g., High Times) has also aided
the effort to spread the facts on marijuana. Taken together, these means of education
seem to be effective enough to have allowed marijuana to persist in our culture. With the
rise of the biotechnology of Cannabis sativa, more people will undoubtedly become
involved in working to understand and discuss potential benefits.
My own use of marijuana has helped stimulate an interest in the sciences and ask more
questions about life. When I was in high school my interest level in learning was below
zero. I barely graduated my senior year. Whether I was bored or not, I can't remember. It
was a time of confusion and fear, not knowing much about myself and listening to what
older people were telling me to do. There was little room for independent thought.
! '%!
When I was finished with high school, I joined the US Army. This wasn't odd,
considering many kids from my town used that as an option for immediate escape into
the world. The military provided comfort in that I was with people my own age, with
similar educational and socioeconomical background, and making friends came fairly
easily. But then I ended up with a life-changing experience while I was serving, one so
radical that many would not believe my story and so I dare not discuss it within the
framework of this book.
I left the military and went back to my hometown. There, I learned about the local
university, where kids were able to take classes of their choice and interest. I enrolled and
within a few weeks I knew that college would be one of the most stimulating things I
may ever encounter. But then, not long after I started my freshman year, I met someone
who smoked marijuana. He was a regular user, probably more than regular actually. I
smoked with him a few times and then I bought a small bag from him.
It was very unfamiliar to me. It was dry, smashed, and smelly. I took it home to the
apartment where I lived alone. I didn't touch it for a few days. I read a little more about
what it was and learned that it was a flower from a plant. Eventually, after I was finished
reading for my modern world civilization class, I loaded a small pipe I had bought, went
to my living room and I took some hits. My house suddenly became very quiet. The small
sounds of the creaky floor and the wind against the windows were very crisp, I was very
alert. At the same time my mind seemed to be speeding through hundreds of ideas each
second.
First I was thinking about Akbar from the ancient Middle East, then Diderot and his
encyclopedia, and then suddenly it was my houseplants and how they were responding to
the dim light of my living room. My mind was simultaneously brought to an ease that I
had never felt before. These two extremes, rapid flow of thoughts and calmness of my
mind, switched back and forth repeatedly for quite some time. Everything in my life
seemed to suddenly make sense and my purpose became obvious. I wanted to learn as
much as I could while in college and make the most out of my life.
I also fell in love that night with a plant called Cannabis sativa. I had found meaning to
my life, and the smoke from my pipe had given me clarity and purpose for college. I
wanted to study my history more, while thinking of the role marijuana played in shaping
it. I wanted to study my human anatomy and physiology book and think about how
marijuana travels through and is metabolized by the human body. I wanted to study my
plant taxonomy book and figure out where Cannabis fit into the diverse kingdom. I
wanted to learn everything I could about everything there was.
Since my undergraduate years have passed, I have smoked less and less marijuana.
However, I have not forgotten its effect on my life. I am grateful for this plant and in
many ways I feel I am indebted to it. It has allowed me to grasp abstract ideas in a more
concrete way and provided me opportunities that I otherwise would have never had. It
has given me motivation and drive to learn. I know that this is not the experience
everyone has after smoking marijuana. Some people who are introduced to it smoke and
! '&!
are not motivated to do anything. For me, the best times of my undergraduate years were
reading quietly for long hours alone in my apartment then smoking and thinking about
what I had just read. For others, they are caught in a vicious and unproductive cycle of
television and video games; they use marijuana to zone out, to avoid the rest of the world.
I can't say this is wrong, but I do wonder why Cannabis has opposite effects on each
person. We need to give more scientific study this plant, both for its biochemistry and its
potential in biotechnology.
Biotechnology may not be limited to Cannabis. For instance, those with the ability to
invest large amounts of money into creating their own labs and hiring competent plant
biotechnologists, may be able to create any plant with any drug they want. Production of
a *******-producing plant that is tolerant of conditions in North America would bring
billions in drug sales. It may also wipe out communities and increase instability among
otherwise stable regions. This is not to say Cannabis biotechnology should not be
pursued. Its use however should remain up to the individual.
One drawback of marijuana use may be when an individual shares their pipe or other
device with friends they may also be sharing oral diseases. A recent opinion article
argued that there might be an increase in the rate of oral cancers among marijuana
smokers. This may not be due to marijuana smoke; rather it is possibly due to passing
virus particles and germs from an infected individual to an uninfected individual
(Zwenger, 2009). For instance, oral human papilloma virus (HPV), commonly associated
with warts in all areas of the body but now being increasingly found in the mouths of
younger people, might be one reason for the increase in oral cancers. HPV has previously
been linked with vaginal and oral cancers.
Therefore, marijuana smokers should be cautious about sharing with anyone, since
detection of HPV is uncommonly reliable by sight alone. This should not discourage one
from smoking with friends. Rather it should serve as beneficial advice. It should serve as
a warning to anyone who cares about his or her future health and safety to retain their
own smoking device for themselves.
Knowledge such as this should not be looked upon as depressing. Indeed, knowledge is a
good thing to posses, whether it is about how the universe operates, the meaning of life,
or Cannabis (which often is the meaning of life for some people). Understanding more
about Cannabis, which is one of the most intriguing plants that humankind has ever
discovered, could allow humans to prosper far beyond their present state. Changing the
genetic structure could prove even more beneficial by discussing its science, chemistry,
and importance to human mental health.
The future is bright for Cannabis biotechnology. There could be no better time to create
transgenic plants harboring select genes. This book has touched on some of the unique
Cannabis plants that are waiting to be created. I leave it to the student of plant
biotechnology to decide when to bring these ideas to reality. Improving Cannabis
through biotechnology will most likely occur within the next decade. The only question
that remains is, who will be the first to smoke it?
! ''!
References:
Armbruster, W. S. “The role of resin in angiosperm pollination: ecological and chemical
considerations.,†Amer J Bot (71) 1986, pp. 1149--1160.
Berghuis, P., Rajnicek, A. M., Morozov, Y. M., Ross, R. A., Mulder, J., Urbán, G. M.,
Monory, K., Marsicano, G., Matteoli, M., Canty, A., Irving, A. J., Katona, I., Yanagawa,
Y., Rakic, P., Lutz, B., Mackie, K. and Harkany, T. "Hardwiring the brain:
endocannabinoids shape neuronal connectivity.," Science (316:5828), 2007, pp. 1212--
1216.
Bou-Torrent, J., Roig-Villanova, I. and Martínez-García, J. F. "Light signaling: back to
space.," Trends Plant Sci (13:3), 2008, pp. 108--114.
Cantrill, S. Nobel Prize 2008: Green fluorescent protein.,†Nature Chem
doi:10.1038/nchem.75, 2008.
Conrad, C. Hemp for health: The medicinal and nutritional uses of Cannabis sativa.,â€
1997, Healing Arts Press.
Dafny-Yelin, M. and Tzfira, T. "Delivery of multiple transgenes to plant cells.," Plant
Physiol (145:4), 2007, pp. 1118--1128.
Harkany, T., Keimpema, E., Barabás, K. and Mulder, J. "Endocannabinoid functions
controlling neuronal specification during brain development.," Mol Cell Endocrinol
(286:1-2 Suppl 1), 2008, pp. S84--S90.
Hazekamp, A., Ruhaak, R., Zuurman, L., van Gerven, J. and Verpoorte, R. "Evaluation
of a vaporizing device (Volcano) for the pulmonary administration of
tetrahydrocannabinol.," J Pharm Sci (95:6), 2006, pp. 1308--1317.
Herer, J. “The Emperor Wears No Clothes: The Authoritative Historical Record of
Cannabis and the Conspiracy Against Marijuana.,†2000, Quick American Archives.
James, C. “Global Status of Commercialized Biotech/GM Crops: 2005.,†2005, ISAAA,
Ithica, NY.
Johnston, J. S., Pepper, A. E., Hall, A. E., Chen, Z. J., Hodnett, G., Drabek, J., Lopez, R.
and Price, H. J. "Evolution of genome size in Brassicaceae.," Ann Bot (Lond) (95:1),
2005, pp. 229--235.
Kirst, M., Johnson, A. F., Baucom, C., Ulrich, E., Hubbard, K., Staggs, R., Paule, C.,
Retzel, E., Whetten, R. and Sederoff, R. "Apparent homology of expressed genes from
wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana.," Proc
Natl Acad Sci U S A (100:12), 2003, pp. 7383--7388.
! '(!
Lydon, J., Teramura, A. H. and Coffman, C. B. "UV-B radiation effects on
photosynthesis, growth and cannabinoid production of two Cannabis sativa
chemotypes.," Photochem Photobiol (46:2), 1987, pp. 201--206.
Marks, L. A., Kalaitzandonakes, N., Wilkins, L., Zakharova. “Mass media framing of
biotechnology news.,†Public Underst Sci (16:2), 2007, pp. 183--203.
McCullen, C. A. and Binns, A. N. "Agrobacterium tumefaciens and plant cell interactions
and activities required for interkingdom macromolecular transfer.," Annu Rev Cell Dev
Biol (22), 2006, pp. 101--127.
Mitsuda, N., Iwase, A., Yamamoto, H., Yoshida, M., Seki, M., Shinozaki, K. and Ohme-
Takagi, M. "NAC transcription factors, NST1 and NST3, are key regulators of the
formation of secondary walls in woody tissues of Arabidopsis.," Plant Cell (19:1), 2007,
pp. 270--280.
Mukherjee, A., Roy, S., De Bera, S., Jiang, H., Li, X., Li, C., Bera, S. “Results of
molecular analysis of an archaeological hemp (Cannabis sativa L.) DNA sample from
North West China.,†Genet Resour Crop Evol (55:4), 2008, pp. 481--485.
Murashige T. and Skoog, F. “A revised medium for rapid growth and bioassays with
tobacco tissue cultures.,†Physiol Plant (15:3), 1962, pp. 473-497.
Pertwee, R. G. "Cannabinoid pharmacology: the first 66 years.," Br J Pharmacol (147
Suppl 1), 2006, pp. S163--S171.
Pichersky, E., Noel, J. P. and Dudareva, N. "Biosynthesis of plant volatiles: nature's
diversity and ingenuity.," Science (311:5762), 2006, pp. 808--811.
Pontes, D. S., Lima-Bittencourt, C. I., Chartone-Souza, E. and Nascimento, A. M. A.
"Molecular approaches: advantages and artifacts in assessing bacterial diversity.," J Ind
Microbiol Biotechnol (34:7), 2007, pp. 463--473.
Ponto, L. L. B. "Challenges of marijuana research.," Brain (129t 5), 2006, pp. 1081--
1083.
Reyes-Prieto, A., Weber, A. P. M. and Bhattacharya, D. "The origin and establishment of
the plastid in algae and plants.," Annu Rev Genet (41), 2007, pp. 147--168.
Robert-Seilaniantz, A., Navarro, L., Bari, R. and Jones, J. D. G. "Pathological hormone
imbalances.," Curr Opin Plant Biol (10:4), 2007, pp. 372--379.
Robinson, R. “The great book of hemp: The complete guide to the environmental,
commercial, and medicinal uses of the world's most extraordinary plant.,†1996, Park
Street Press, Rochester, VT.
! ')!
Romeis, J., Meissle, M. and Bigler, F. "Transgenic crops expressing Bacillus
thuringiensis toxins and biological control.," Nat Biotechnol (24:1), 2006, pp. 63--71.
Sheen, J., Hwang, S., Niwa, Y., Kobayashi, H. and Galbraith, D. W. "Green-fluorescent
protein as a new vital marker in plant cells.," Plant J (8:5), 1995, pp. 777--784.
Sirikantaramas, S., Morimoto, S., Shoyama, Y., Ishikawa, Y., Wada, Y., Shoyama, Y.
and Taura, F. "The gene controlling marijuana psychoactivity: molecular cloning and
heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis
sativa L.," J Biol Chem (279:38), 2004, pp. 39767--39774.
Sirikantaramas, S., Taura, F., Morimoto, S. and Shoyama, Y. "Recent advances in
Cannabis sativa research: biosynthetic studies and its potential in biotechnology.," Curr
Pharm Biotechnol (8:4), 2007, pp. 237--243.
Sirikantaramas, S., Taura, F., Tanaka, Y., Ishikawa, Y., Morimoto, S. and Shoyama, Y.
"Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana psychoactivity,
is secreted into the storage cavity of the glandular trichomes.," Plant Cell Physiol (46:9),
2005, pp. 1578--1582.
Smith, R. “Plant tissue culture: Techniques and experiments.,†2008, Academic Press.
Soltis, D. E., Ma, H., Frohlich, M. W., Soltis, P. S., Albert, V. A., Oppenheimer, D. G.,
Altman, N. S., dePamphilis, C. and Leebens-Mack, J. "The floral genome: an
evolutionary history of gene duplication and shifting patterns of gene expression.,"
Trends Plant Sci (12:8), 2007, pp. 358--367.
Stewart, S. “Plant biotechnology and genetics: Principles, techniques and applications.,â€
2008, Wiley-Interscience.
Taura, F., Dono, E., Sirikantaramas, S., Yoshimura, K., Shoyama, Y. and Morimoto, S.
"Production of Delta(1)-tetrahydrocannabinolic acid by the biosynthetic enzyme secreted
from transgenic Pichia pastoris.," Biochem Biophys Res Commun (361:3), 2007, pp. 675--
680.
Taura, F., Sirikantaramas, S., Shoyama, Y., Shoyama, Y. and Morimoto, S.
"Phytocannabinoids in Cannabis sativa: recent studies on biosynthetic enzymes.," Chem
Biodivers (4:8), 2007, pp. 1649--1663.
Thomson, J. “Tactics for male reproductive success in plants: contrasting
insights of sex allocation theory and pollen presentation theory.,†Integr Comp Biol
(46:4), 2006, pp. 390--397.
Thorpe, T. A. "History of plant tissue culture.," Mol Biotechnol (37:2), 2007, pp. 169--
180.
! (+!
Vaughan, D. A., Balázs, E. and Heslop-Harrison, J. S. "From crop domestication to
super-domestication.," Ann Bot (Lond) (100:5), 2007, pp. 893--901.
Venter, M. "Synthetic promoters: genetic control through cis engineering.," Trends Plant
Sci (12:3), 2007, pp. 118--124.
Wang, Q. and Guanming S. “Industrial Hemp: China's experience and global
implications.,†Rev Ag Eco, (21:2), 1999, pp. 344-57.
Yuan, Z.-C., Haudecoeur, E., Faure, D., Kerr, K. F. and Nester, E. W. "Comparative
transcriptome analysis of Agrobacterium tumefaciens in response to plant signal salicylic
acid, indole-3-acetic acid and gamma-amino butyric acid reveals signalling cross-talk and
Agrobacterium--plant co-evolution.," Cell Microbiol (10:11), 2008, pp. 2339--2354.
Zwenger, S. “Bogarting that joint might prevent oral HPV among Cannabis users.,†Curr
Oncol. (16), 2009. In Press.
! (*!
Appendix A
Presented here is a representative list of genes with the potential to be used for
transforming (or up-regulating) into Cannabis plants. Gene symbols are given along with
the complete name, which also may describe the function. Although these were originally
described in the model plant Arabidopsis thaliana, they most likely have analogous
sequences in Cannabis sativa. It should be noted that this is not an exhaustive list and
many other genes could be transformed into Cannabis. For example, the gene for the
ability to make tendrils, which are simply modified leaves, is not listed.
E1)1*J9#6"2* Complete Gene Name
CUQ! ! ! C9233./0!:;-8386-.505
CUK C9/831.-L!.98302B!522B5
CQM C-0232B!:2--!@.--
CIX Adagio
CYK, Separase
AFO Abnormal floral organs
ALAC Alarm clock
ALE Abnormal leaf shape
AN Angustifolia
AS Asymmetric leaves
BAL Ball
BAM Big apical meristem
BDY Buddy
BIF Bifid stigma
BLB Blueberry
BNS Bonsai
BPE Bigpetal
BSH Bushy plants
BST Bristled
BUD Bulkhead
BUS Bushy
CA Caespitosa
CAF Carpel factory
CBB Cabbage
CEL Callus expression of RBCL
CHP Chlorophyll mutant
CLV Extra carpels
CLY Early flowering
COD Cone head
CTS Comatose
CUT Altered epicuticular wax
CYL Cyclops
DFL Dwarf in light
! ("!
DIS Distorted trichomes
DLS Delayed leaf senescence
DM Dangerous mix
DPR Drought and pathogen resistant
DRA Dracula
DRO Drought tolerant
DSR Dark green leaves, stunted roots
DVL Devil
DWG Dwarf gigantica
DYA Dyad
EAF Early flowering
ECL Early curly leaf
EEP Early extra petals
ELF Early flowering
ELG Elongated
ELL Extra long lifespan
ER Erecta
ERH Ectopic root hair
ERT Early trichomes
ESI Elongated, stout internodes
ESK Eskimo
EXC Extra cells
EXI Exigua
FAC Embryonic factor
FAF Fantastic four
FAX Fewer axillary branches
FDH Fiddlehead
FE Late flowering
FEY Forever young
FIF Flower in flower
FIL Filamentous flower
FKD Forked
FLH Flowering H
FLK Flaky pollen
FTR Fat root
GCT Grand central
GGL Gargoyle
GI Gigantea, late flower
GLM Gollum
GLO Glabrous, chlorotic
GMB Gumby
GRA Grandifolia
GRE Glyphosate responsive
GRM Gremlin
GTR Glassy trichome
HAP Hapless
! (#!
HBT Hobbit
HCA High cambial activity
HIC High carbon dioxide
HIO High oil (altered seed content)
HOR High expression of abiotic responsive gene
HRT Heartless
HST Hasty
HYV High vigour
IAD Increased apical dominance
ICA Icarus
ICU Incurvata
IKU Haiku
IMP Impotent
IRN Yellow-green
ITN Increased tolerance to NaCl
IVR Invasive root
ZC[! ! Z.<<2B
ZCM K233.02B!-2.J25
ZK\ Z.58/
]C] ].N0=5! !
]Y[! ! ! ]226!8/!<84/<
]Y^! ! ! ]2=-2
]S,! ! ]4/N7!68--2/
]Z]! ! ! ]8O.N
]_,! ! ]37608/402
]\U! ]/89;2.B
VCI! ! V.02!./0;23!B2;45:2/:2
VYR! ! ! V2.A!1836;8<2/2545!B453=602B
VTM! ! V8/25812!;4<;@.7
VS?! ! V48/5!0.4-
RCC! ! ! R.<.0.1.
RCI! ! ! R.-2!<.12086;704:!B2A2:04J2
RCV! ! ! R.39-2B!-2.J25
RPX! ! ! R=-04A8-4.!1./7!-2.J25
RSQ! ! R4:N27
RXI! ! ! R85.4:!B2.0;
RKT! ! ! R./7!5;8805
\XQ! ! ! \8!:807-2B8/5
NOT Loves-me-not
NPG No pollen germination
NSM Insomniac
NZZ Nozzle
OLT Old timer
OMO Odd man out: male meiosis defective
ORB Orbiculata
PAC Pale cress
! ($!
PAN Extra perianth organs
PBH paintbrush
PBO Peek-a-boo
PBR Polar bare
PCK Peacock
PCL Phytoclock
PEP Pepper
PHD Pothead
PI Pistillata
PIC Pinocchio
PKL Pickle
PLT Plethora
PLU Pluto
PNT Peanut
POL Poltergeist
PRA Prairie
PRK Peter Parker
PRS Pressed flower
QBL Quibble
QRT Quartet
QUA Quasimodo
RAT Resistant to Agrobacterium transformation
RBE Rabbit ears
RBY Ruby
RCK Rock-n-rollers
RCU Recurvata
RD Rotundata
RED Red light elongated
RFI Rastafari
RGM Rapid germination
RLP Revertant for leafy petiole
RNT Runt
RON Rotunda
ROU Rouge
RTY Rooty
RUG Rugosa
SAB Sabre
SAG Sagittatus
SAW Sawtooth
SCA Scabra
SCF Scarface
SCN Supercentipede
SDD Stomatal density, distribution
SEA Serrata
SHD Shepherd
SHI Short internodes
! (%!
SHN Shine
SHV Shaven
SLK Seuss-like
SLO Slowcoach
SLOMO Slowmotion
SMB Sombrero
SML Stamen loss
SNO Snoball
SNV Supernova
SPCH Speechless
SPK Spock
SPR Spiral
SPS Supershoot
SPT Spatula
SRB Shoot and root branching
SSE Shrunken seed
STA Satchel
SUP Superman
SWE Sweetie
TARA Tarantula
TASTY Tasty
TAX Trichome anthocyanin expansion
TBR Trichome birefringence
TCU Transcurvata
TDL Trichome density locus
TFA Things fall apart
TIL Tilted
TIN Tinman
TIO Two-in-one
TLZ Tlazolteotl
TMM Too many mouths
TNY Tiny
TOAD Toadstool
TOP Tower of Pisa
TPL Topless
TRL Troll
TRN Tornado
TRY Triptychon
TWD Twisted dwarft
UCN Unicorn
UCU Ultracurvata
UFO Unusual floral organs
ULA Hula
ULT Ultrapetala
UMA Umami
URM Unarmed
! (&!
URO Upright rosette
UTC Up the creek
Uzi Unzipped
VAR Variegated
VCH Vertically challenged
VEP Vein patterning
VHE Van Helsing
VHI Vascular highway
VIR Virescent
WAG Wag
WAR Wax restorer
WCO White cotyledons
WDY Woody
WER Werewolf
WHG Warthog
WIG Wiggum
WLC Wavy leaves, cotyledons curled back
WOL Wooden leg
WOW Wonderwoman
WVS Wavy sepal
WYR Wryd
XS Extra-small sisters
XTG Extinguisher
YAB Yabby
YAK Yakka
YDA Yoda
YEL Yellow
YI Yellow inflorescence
YOR Yosemite resistance
YSV You're so vein
YUC Yucca
ZEU Zeus
ZIG Zig zag stem
ZLL Zwille
ZPL Zeppelin
ZPY Zippy
ZWG Zwergerl
ZWI Zwichel
! ('!
Appendix B
Provided here is a small representation of the many biotechnology companies that are
currently selling useful products for plant biotechnology research. Each company varies
by product and location, while some companies specialize in only certain products.
Needless to say, there are many other companies in addition to the ones listed here.
-Bio-Rad, Bio-Rad Laboratories
This company sells electroporation equipment, although these devices are often very
expensive. They also sell a huge variety of molecular research tools and reagents for labs
ranging from labs with high-tech needs to high school labs.
-Carolina Biological Supply Company, Carolina Biological Supply: Science Supplies, AP Kits, Chemistry Supplies, Microscopes
This is primarily a company that specializes in classroom kits and products. However,
they also sell callus initiation media, containers and dishes for plant tissue culture, and
pre-made sterile media.
-Eppendorf, 420 Girls - Creating Cannabis Awareness Since 1993
This is perhaps one of the world's largest suppliers of biotechnology equipment and sells
plastic-ware and pipettors to distribute cells and small amounts of liquid.
-Lucigen Corporation, Advanced Products for Molecular Biology - Lucigen Corporation
This international company sells different kits to splice and cut genes into different
vectors and have established themselves as a reliable source for biotechnology research.
Additionally, they offer cDNA library construction.
-pGreen, https://www.pgreen.ac.uk
pGreen is part of the biotechnology resources for Arable Crop Transformation (BRACT),
located in the UK. This is one of the best resources for purchasing strains of
Agrobacterium. Agrobacterium cells that have been transformed with GFP can be
purchased here as well.
-Hoffmann-La Roche, Roche - We innovate healthcare
Although best known for its biomedical supplies, this Swiss company is a giant in the
biotechnology industry and sells enzymes and cells, which may be pertinent to some
experiments in plant biotechnology.
-Sentryair Purification Systems, Air Purification Systems, Ductless Hoods & Fume Extractors
This company specializes in providing sterile working conditions, that is crucial in plant
biotechnology experiments. They offer a huge selection of laminar flow hood models and
sizes.
Sigma-Aldrich, Sigma-Aldrich: Analytical, Biology, Chemistry & Materials Science products and services.
A huge chemical supply company with locations in multiple countries that sells
chemicals of all kinds. Some of its newest products focus on RNAi research.
! ((!
-Streamline Laboratory Prodcuts, https://www.streamlinelab.com
This company offers laminar flow hoods, PCR hoods, ductless hoods, and tissue culture
hoods. They supply many different models with a variety of price ranges.
! ()!
Glossary
2,4-dichlorophenoxyacetic acid (2,4-D)- an auxin hormone that causes cell division and
root formation
abscisic acid- a cytokinin used to promote cell division and shoot formation
achene- a type of fruit that has
agar- polysaccharide used to solidify media
Agrobacteirum- bacteria used to infect plants and transfer foreign DNA
alternation of generations- the life cycle of plants that alternates between a haploid
gametophyte and a diploid sporophyte
annual- a plant that lives for only one year
antibiotic- chemical that can inhibit cells from growing
apical dominance- the case where a terminal bud suppresses the growth of lateral buds
archaea- one of the three domains of life that is composed of extremophiles
asexual propagation- process where cuttings of a plant can be re-grown into complete
organisms
Asteraceae- the sunflower or composite plant family
auxin- plant hormone involved in root formation and used in tissue culture
bacteria- one of the three domains of life that contains most bacteria; a single celled
prokaryote
biotechnology- the process where cells are manipulated for desirable genetic outcomes
bud- a general term for a flower
callus- an undifferentiated mass of plant cells
callus media- growth substrate used for growing bits of plant stem into calluses
calyx- term used for that includes all of the sepals
Cannabaceae- the Cannabis and hops plant family
! )+!
Cannabis sativa- the scientific name for marijuana plant
carbohydrate- an organic molecule such as cellulose or glucose that can be used for
energy
carpel- the female reproductive part of the flower
cDNA library- a collection of sequences that represent actively transcribed genes
cell- the smallest unit of life; many cells constitute a tissue
cell wall- the outer layer of the cell that serves to protect and maintain the contents of the
cell
cellulose- large polysaccharide that is the main constituent of plant cell walls
central dogma of biology- fundamental process of biology where a gene is transcribed
into mRNA, which is then translated into a protein
chromosome- the piece of DNA that harbors genes, it is composed of many nucleic acids
co-cultivation- process in plant tissue culture that allows time for the Agrobacterium to
infect the callus
complimentary DNA (cDNA)- reverse transcribed mRNA that represents an expressed
gene
corolla- term for all the flower petals combined
cytochromes- plant proteins responsible for detecting various wavelengths of light
cytokinins- plant hormones that can induce cell division and shoot formation
cytoplasm- the intracellular matrix in which organelles, proteins and molecules are
suspended in
deoxyribonucleic acid (DNA)- a polymer that is the genetic material of all life
dimethylallyl pyrophosphate/diphosphate (DMAPP)- molecule used in the synthesis of
terpenes
diploid- having two copies of each chromosome
electroporation- process where Agrobacterium is induced to take up foreign DNA using
an electric shock
! )*!
endosymbiosis- an even that occurred early in the evolution of life and led to eukaryotic
organisms
enzyme- a protein that acts as a catalyst to speed up a reaction
epidermis- the outermost layer of plant tissue
ethylene- a small gaseous molecule that is also a plant hormone that speeds fruit ripening
eukaryote- an organisms that has double-membrane structures and a nucleus
explant- term used for the bits of plant stem that are placed onto the culture media
family- a classification groups that many plant taxonomists are familiar with
flower- the reproductive structure of angiosperms
funiculus- the small stalk that connects the seed to the pericarp
gene- sequence on DNA that can code for a protein
gene gun- device used to transfer foreign DNA into cells using high velocity microbeads
gene stacking- transferring many foreign genes simultaneously
genome- the complete set of genes an organism posses
gibberellins- plant hormones that can increase height of a plant
glucose- a carbohydrate monomer that is used for energy or in biosynthesis to create
larger polymers
green fluorescent protein (GFP)- a barrel-shaped protein
haploid- having a single copy of a gene
heat shock- process of briefly heating a bacterium to make it take up foreign DNA
hemp- a low THC-containing Cannabis plant known for its tough fibers
homology- having similar sequence or structure in two different species
indole-3-acetic acid (IAA)- an auxin plant hormone that stimulates root production and
cell division
isopentenyl pyrophosphate/diphsphate (IPP)- a carbon building block used in terpene
! )"!
biosynthesis
isoprene- a five carbon molecule, which is often the product of terpene degradation
kanamycin- antibiotic used to select for transgenic calluses
kilobase (kb)- a thousand bases
kingdom- one of the highest ranks of classification, which includes plants, fungi, animals
and protists
laminar flow hood- an enclosed chamber that uses a negative air pressure to maintain
sterile working conditions
Leguminosae- plant family of beans
lignification- the process of laying down lignin in the cell wall
lignin- a polysaccharide that gives strength and rigidity to the plant cell
lipid- one of the four macromolecules of life that are the main constituents of cell
membranes
meristematic region- location of actively dividing cells
messenger RNA (mRNA)- the molecule synthesized from the DNA template used to
make a protein
mevalonate- the end product of the mevalonate terpene pathway that occurs in the
cytoplasm
microbe- a microscopic organism, usually refers to either bacteria or fungus
molecule- a compound made up of multiple elements, e.g. a water molecule
morphology- the overall appearance or shape
morph- abbreviation for morphology
Musharige-Skoog (MS) media- the most commonly used plant tissue culture media for
developing calluses into plants
nanometer (nm)- a billionth of a meter
northern blot- technique used to confirm expression of a gene
! )#!
nucleotide base- component of nucleic acids that can be either adenine, guanine, cytosine,
thymine, or uracil
nucleus- the area of a eukaryotic cell where chromosomal material is stored
organogenesis- the process by which totipotent cells develop into shoots and roots
perennial- a plant that lives more than one year
pericarp- the outer layer of the fruit
petal- floral whorl in plants often colored to act as an attractant
Petri dish- plastic or glass plate used to culture or keep cells
phenolic ring- a circularized six carbon molecule
photoperiod- the length of daylight that is one method plants use to detect seasonality
photosynthesis- the process of converting radiant energy into chemical energy
plasmid- an extra chromosomal piece of DNA, often circular in shape
plastid- a plant organelle in the cytoplasm that can make or store food
polymerase chain reaction (PCR)- a series of heating and cooling that results in
amplification of a gene product
polysaccharide- a polymer of sugar subunits
prokaryote- a single celled organism that lacks a nucleus; a bacteria
promoter- region of a gene that helps dictate the rate at which mRNA is made
protein- a polymer of amino acids that is often an enzyme
reporter gene- a gene used in biotechnology to confirm transformation
resin- a complex mixture of plant secondary metabolites in a liquid matrix
reverse transcription- process where an mRNA molecule is made back into DNA
root hairs- often microscopic protrusions of the roots that increase surface area
secondary xylem- wood
sepal- a subunit of the calyx; the floral bract at the base of most flowers
! )$!
southern blot- molecular biology tool that allows detection of a gene
species- the classifying unit in biology that falls under genus
spore- a microscopic asexual unit capable of generating an entire organism
stamen- the male reproductive part of a flower
terpene- a large class of plant secondary metabolites
tetrahydrocannabinol (THC)- the main psychoactive component of Cannabis
THCA synthase- the enzyme responsible for converting cannabigerolic acid to THCA
tissue- similar cells working together
tissue culture- technique where plants can be grown in vitro
totipotency- having the capability to turn into any type of cell
transcription- conversion of DNA to mRNA
transcription factor- small protein that helps regulate transcription
transfer DNA (T-DNA)- part of the DNA that is transferred from Agrobacterium to a
plant cell
transfer RNA (tRNA)- small RNA molecule that carries the amino acid to the site of
protein synthesis
transgenic- term used for an organism that has been genetically modified
transpiration- process where water moves from roots and through the xylem and out of
the stomata
trichomes- modified epidermal cells that can help in water retention
tween20- a mild detergent used to wash freshly cut stems
up-regulation- process where a gene is expressed at a higher rate
western blot- method used in molecular biology to study proteins
xylem- part of the vasculature of plant that conducts water
! )%!
I hope you enjoyed this scientific-based book on the exciting field of plant biotechnology
with a special focus on its relationship with Cannabis sativa, commonly known as
marijuana. This world-renowned herb has captured the interest of nearly every culture on
every continent for hundreds, and in some instances, thousands of years. Although, now
in the twenty first century, crop plants are being genetically modified to better suit the
needs of society, marijuana has not received the same level of attention.
This book describes the merging of two important subjects, marijuana and plant
biotechnology. Marijuana's role in the biotechnology age is outlined and described in this
book with the equal hopes of encouraging research to improve this plant and to inspire
young people to pursue a lifetime of learning.
About the Author:
Sam is a graduate student studying plant biotechnology at the University of Northern
Colorado. Although his research focuses on plant terpenoids, he has secondary interests
that include astronomy, music, and the role of science in society.​

 

[The Lurker]

Light reading...cool! Only 95 pages--!

Thanks velo!

---

For anyone who wants to check out the source, here's a link to the original document with several format options (left-hand pane). They've even got a Kindle version for you e-reader folks(!):

The Biotechnology Of Cannabis Sativa

Here's a direct download link to the PDF HERE (~8 MB). This also includes pics, and the formatting is perhaps a little easier on the eyes...

-TL

 

[evergren420]

It's quite impossible for me to read through your explanation. What have you wanted to make us understand? could you please simply describe?